Mutagenetix > Incidental Mutation

Incidental Mutation 'R6416:Azin1'

517959

Institutional Source

Beutler Lab

Gene Symbol

Azin1

Ensembl Gene

ENSMUSG00000037458

Gene Name

antizyme inhibitor 1

Synonyms

ODC antizyme inhibitor, Oazi, Oazin, 1700085L02Rik

MMRRC Submission

044558-MU

Accession Numbers

Genbank: NM_018745; MGI: 1859169

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6416 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38487427-38519266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38492343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 307 (S307R)

Ref Sequence

ENSEMBL: ENSMUSP00000105958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065308] [ENSMUST00000110329] [ENSMUST00000129589]

AlphaFold

O35484

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065308
AA Change: S307R

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000065544
Gene: ENSMUSG00000037458
AA Change: S307R

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	279	5.2e-66	PFAM
Pfam:Orn_DAP_Arg_deC	282	406	1.4e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110328

SMART Domains

Protein: ENSMUSP00000105957
Gene: ENSMUSG00000037458

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	279	9.4e-67	PFAM
Pfam:Orn_DAP_Arg_deC	282	357	7.4e-10	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110329
AA Change: S307R

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105958
Gene: ENSMUSG00000037458
AA Change: S307R

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	279	5.4e-69	PFAM
Pfam:Orn_DAP_Arg_deC	283	405	3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129589

SMART Domains

Protein: ENSMUSP00000117988
Gene: ENSMUSG00000037458

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	154	1.8e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149293

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183910

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226152

Meta Mutation Damage Score

0.0953

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.4%
20x: 94.6%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous disruption of this gene results in neonatal lethality, a slight reduction in birth weight, and abnormal liver morphology. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	C	A	16: 88,707,891	R6L	unknown	Het
Anxa11	A	G	14: 25,874,270	Q235R	possibly damaging	Het
Ap2b1	T	A	11: 83,308,239	M1K	probably null	Het
Atl2	G	A	17: 79,850,223	T563I	probably benign	Het
Ccdc153	A	G	9: 44,245,780	T118A	probably benign	Het
Chac1	G	A	2: 119,353,534	V206I	probably damaging	Het
Chrm3	A	G	13: 9,877,662	V446A	probably benign	Het
Cped1	T	C	6: 22,123,649	F467S	probably damaging	Het
Csmd3	G	A	15: 48,673,560	P82L	probably damaging	Het
Ddx60	T	A	8: 61,977,950	S840T	probably benign	Het
Ddx60	C	T	8: 61,998,681	H1202Y	probably benign	Het
Dnah8	T	A	17: 30,765,635	N3102K	probably benign	Het
Dst	A	T	1: 34,116,128	K85M	probably damaging	Het
Ehbp1l1	T	C	19: 5,718,757	I839M	probably benign	Het
Fam184b	T	A	5: 45,537,653	M750L	probably benign	Het
Frem2	T	C	3: 53,572,378	T1965A	probably benign	Het
Ftl1	A	T	7: 45,459,210	D41E	probably benign	Het
Garem2	G	A	5: 30,116,737	W698*	probably null	Het
Glt8d2	T	C	10: 82,652,906	Y283C	probably damaging	Het
Hars	T	C	18: 36,773,590	E109G	possibly damaging	Het
Hspb9	T	C	11: 100,714,210	S121P	probably damaging	Het
Hus1b	A	T	13: 30,947,205	L157Q	probably damaging	Het
Hykk	A	G	9: 54,946,359	M322V	probably benign	Het
Igkv4-61	C	A	6: 69,417,154	A31S	possibly damaging	Het
Il17f	T	A	1: 20,777,907	M116L	probably benign	Het
Kif22	T	C	7: 127,028,932	K9E	possibly damaging	Het
Krt90	T	C	15: 101,559,244	E233G	probably benign	Het
Lipg	T	C	18: 74,957,236	M81V	probably benign	Het
Mocos	C	T	18: 24,701,456	S850L	probably damaging	Het
Mug2	T	A	6: 122,082,754	S1364T	probably damaging	Het
Neb	A	T	2: 52,185,328	N208K	probably benign	Het
Oca2	G	T	7: 56,328,767	R561L	probably benign	Het
Olfm5	A	G	7: 104,154,053	L401P	probably damaging	Het
Olfr109	T	A	17: 37,467,080	Y291*	probably null	Het
Olfr1238	C	A	2: 89,406,522	A186S	possibly damaging	Het
Olfr331	T	C	11: 58,502,340	D72G	probably damaging	Het
Olfr828	G	A	9: 18,815,892	T134M	probably benign	Het
Olfr952	T	A	9: 39,426,891	Y60F	probably damaging	Het
Oxgr1	T	C	14: 120,022,448	N116D	probably damaging	Het
Pcdha11	G	T	18: 37,012,169		probably null	Het
Pi4ka	T	C	16: 17,358,322	I418V	probably benign	Het
Pih1d2	T	C	9: 50,618,609	V62A	probably benign	Het
Pkib	T	A	10: 57,728,138	V46E	probably damaging	Het
Pum1	A	G	4: 130,728,287		probably null	Het
Rbak	G	T	5: 143,176,552	Q19K	possibly damaging	Het
Sema3c	A	G	5: 17,576,961	T32A	probably damaging	Het
Shprh	T	C	10: 11,167,873	W835R	probably damaging	Het
Sis	T	G	3: 72,911,854	K1456N	probably damaging	Het
Slc4a4	A	T	5: 89,179,729	N675I	probably benign	Het
Slc8a3	C	A	12: 81,315,627	M139I	probably damaging	Het
Sorcs3	T	C	19: 48,802,759	F1182S	probably damaging	Het
St8sia2	A	T	7: 73,971,921	I96N	probably damaging	Het
Stx19	T	C	16: 62,822,057	S79P	probably damaging	Het
Tecta	C	T	9: 42,375,267	V698M	probably damaging	Het
Timm22	T	C	11: 76,411,139	S150P	probably damaging	Het
Tjp1	C	T	7: 65,313,205	D995N	possibly damaging	Het
Tmem135	T	A	7: 89,147,794	T365S	probably benign	Het
Tmem174	T	C	13: 98,636,981	T114A	probably benign	Het
Tnc	A	G	4: 64,007,816	I909T	probably benign	Het
Trcg1	A	G	9: 57,241,330	I62V	possibly damaging	Het
Tulp1	A	T	17: 28,356,031	*487K	probably null	Het
Unc79	T	A	12: 103,131,646	V1826E	possibly damaging	Het
Vmn2r13	A	T	5: 109,174,116	N238K	probably damaging	Het
Vmn2r22	T	A	6: 123,637,738	N298Y	probably damaging	Het
Vmn2r23	T	A	6: 123,712,902	F246I	probably damaging	Het
Vps9d1	A	C	8: 123,248,639	V194G	probably damaging	Het
Zfp260	A	T	7: 30,104,810	H45L	possibly damaging	Het
Zfp846	A	T	9: 20,593,720	H292L	possibly damaging	Het

Other mutations in Azin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02174:Azin1	APN	15	38493486	missense	probably benign
IGL02406:Azin1	APN	15	38491565	missense	probably benign	0.00
H2330:Azin1	UTSW	15	38497276	missense	probably damaging	0.98
R0562:Azin1	UTSW	15	38493581	missense	probably benign	0.00
R3416:Azin1	UTSW	15	38493546	missense	possibly damaging	0.89
R3434:Azin1	UTSW	15	38493576	missense	probably benign	0.00
R3978:Azin1	UTSW	15	38498713	missense	probably damaging	0.99
R4535:Azin1	UTSW	15	38493605	missense	probably benign	0.11
R4720:Azin1	UTSW	15	38493500	missense	probably benign	0.43
R5266:Azin1	UTSW	15	38491551	missense	probably benign
R7242:Azin1	UTSW	15	38501505	start codon destroyed	probably null	1.00
R7283:Azin1	UTSW	15	38501408	missense	probably damaging	0.98
R7577:Azin1	UTSW	15	38501421	missense	probably benign	0.01
R7604:Azin1	UTSW	15	38491634	missense	probably damaging	1.00
R8221:Azin1	UTSW	15	38492328	missense	probably damaging	1.00
R8683:Azin1	UTSW	15	38493531	missense	probably damaging	1.00
R9229:Azin1	UTSW	15	38490402	missense	probably benign
R9420:Azin1	UTSW	15	38493627	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GGACTCTGACCTCTATTCAAGTCCC -3'
(R):5'- GTGGACCACAACAATAGGCC -3'

Sequencing Primer
(F):5'- GGACAACTTGCATGGATCAGTTCTC -3'
(R):5'- CCCAGTCTCAGTACTGGATTGAG -3'

Posted On

2018-05-24