Incidental Mutation 'R6416:Azin1'
ID517959
Institutional Source Beutler Lab
Gene Symbol Azin1
Ensembl Gene ENSMUSG00000037458
Gene Nameantizyme inhibitor 1
SynonymsODC antizyme inhibitor, Oazi, Oazin, 1700085L02Rik
MMRRC Submission
Accession Numbers

Genbank: NM_018745; MGI: 1859169

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6416 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location38487427-38519266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38492343 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 307 (S307R)
Ref Sequence ENSEMBL: ENSMUSP00000105958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065308] [ENSMUST00000110329] [ENSMUST00000129589]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065308
AA Change: S307R

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065544
Gene: ENSMUSG00000037458
AA Change: S307R

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.2e-66 PFAM
Pfam:Orn_DAP_Arg_deC 282 406 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110328
SMART Domains Protein: ENSMUSP00000105957
Gene: ENSMUSG00000037458

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 9.4e-67 PFAM
Pfam:Orn_DAP_Arg_deC 282 357 7.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110329
AA Change: S307R

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105958
Gene: ENSMUSG00000037458
AA Change: S307R

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.4e-69 PFAM
Pfam:Orn_DAP_Arg_deC 283 405 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129589
SMART Domains Protein: ENSMUSP00000117988
Gene: ENSMUSG00000037458

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 154 1.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226152
Meta Mutation Damage Score 0.0953 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous disruption of this gene results in neonatal lethality, a slight reduction in birth weight, and abnormal liver morphology. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Azin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Azin1 APN 15 38493486 missense probably benign
IGL02406:Azin1 APN 15 38491565 missense probably benign 0.00
H2330:Azin1 UTSW 15 38497276 missense probably damaging 0.98
R0562:Azin1 UTSW 15 38493581 missense probably benign 0.00
R3416:Azin1 UTSW 15 38493546 missense possibly damaging 0.89
R3434:Azin1 UTSW 15 38493576 missense probably benign 0.00
R3978:Azin1 UTSW 15 38498713 missense probably damaging 0.99
R4535:Azin1 UTSW 15 38493605 missense probably benign 0.11
R4720:Azin1 UTSW 15 38493500 missense probably benign 0.43
R5266:Azin1 UTSW 15 38491551 missense probably benign
R7242:Azin1 UTSW 15 38501505 start codon destroyed probably null 1.00
R7283:Azin1 UTSW 15 38501408 missense probably damaging 0.98
R7577:Azin1 UTSW 15 38501421 missense probably benign 0.01
R7604:Azin1 UTSW 15 38491634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTCTGACCTCTATTCAAGTCCC -3'
(R):5'- GTGGACCACAACAATAGGCC -3'

Sequencing Primer
(F):5'- GGACAACTTGCATGGATCAGTTCTC -3'
(R):5'- CCCAGTCTCAGTACTGGATTGAG -3'
Posted On2018-05-24