Incidental Mutation 'R6416:Olfr109'
ID517967
Institutional Source Beutler Lab
Gene Symbol Olfr109
Ensembl Gene ENSMUSG00000029184
Gene Nameolfactory receptor 109
SynonymsGA_x6K02T2PSCP-1914078-1915022, MOR250-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6416 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37458916-37471590 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 37467080 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 291 (Y291*)
Ref Sequence ENSEMBL: ENSMUSP00000150044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031086] [ENSMUST00000214668] [ENSMUST00000214938] [ENSMUST00000217602]
Predicted Effect probably null
Transcript: ENSMUST00000031086
AA Change: Y291*
SMART Domains Protein: ENSMUSP00000031086
Gene: ENSMUSG00000029184
AA Change: Y291*

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 3.4e-54 PFAM
Pfam:7tm_1 39 291 6.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214668
AA Change: Y291*
Predicted Effect probably null
Transcript: ENSMUST00000214938
AA Change: Y291*
Predicted Effect probably null
Transcript: ENSMUST00000217602
AA Change: Y291*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Olfr109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Olfr109 APN 17 37466758 missense probably damaging 1.00
IGL02039:Olfr109 APN 17 37466449 missense possibly damaging 0.49
IGL02391:Olfr109 APN 17 37466586 missense probably damaging 1.00
IGL02730:Olfr109 APN 17 37466859 missense probably damaging 1.00
IGL02751:Olfr109 APN 17 37466415 missense probably damaging 0.98
IGL02891:Olfr109 APN 17 37466944 missense probably damaging 1.00
IGL03023:Olfr109 APN 17 37466994 missense probably benign
IGL03343:Olfr109 APN 17 37466409 missense probably damaging 1.00
R0026:Olfr109 UTSW 17 37466803 missense probably damaging 0.99
R0579:Olfr109 UTSW 17 37466347 missense probably benign 0.01
R1751:Olfr109 UTSW 17 37466901 missense probably benign 0.00
R1848:Olfr109 UTSW 17 37467047 missense probably damaging 0.99
R2392:Olfr109 UTSW 17 37466419 missense probably damaging 1.00
R4249:Olfr109 UTSW 17 37466824 missense probably damaging 0.98
R4464:Olfr109 UTSW 17 37466851 missense probably damaging 1.00
R4857:Olfr109 UTSW 17 37466823 missense possibly damaging 0.80
R4947:Olfr109 UTSW 17 37466743 missense probably damaging 1.00
R5107:Olfr109 UTSW 17 37466253 missense probably damaging 0.97
R5526:Olfr109 UTSW 17 37467112 missense unknown
R6147:Olfr109 UTSW 17 37466539 missense probably benign 0.00
R7450:Olfr109 UTSW 17 37466616 missense probably benign 0.00
R7487:Olfr109 UTSW 17 37466566 missense probably damaging 0.96
R7822:Olfr109 UTSW 17 37467103 missense probably benign 0.00
R8041:Olfr109 UTSW 17 37466649 missense probably benign
R8051:Olfr109 UTSW 17 37466322 missense probably damaging 1.00
X0063:Olfr109 UTSW 17 37466524 missense probably damaging 1.00
X0065:Olfr109 UTSW 17 37466318 missense probably damaging 1.00
Z1176:Olfr109 UTSW 17 37466661 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGTCCTGCAGAATGCTTAAGAAGG -3'
(R):5'- TGAAACTTGAACTTTCTGTCTTGCC -3'

Sequencing Primer
(F):5'- AAGAAGGCTCTGTCTACCTGC -3'
(R):5'- AACTTTCTGTCTTGCCTGAAATATTC -3'
Posted On2018-05-24