Incidental Mutation 'R6416:Pcdha11'
ID517971
Institutional Source Beutler Lab
Gene Symbol Pcdha11
Ensembl Gene ENSMUSG00000102206
Gene Nameprotocadherin alpha 11
SynonymsA830022B16Rik, Crnr7, Cnr7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6416 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37010712-37187657 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 37012169 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192447] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097612
Predicted Effect possibly damaging
Transcript: ENSMUST00000115657
AA Change: V438F

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206
AA Change: V438F

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115658
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192447
AA Change: V438F

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206
AA Change: V438F

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000193856
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194050
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194691
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195341
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Pcdha11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pcdha11 APN 18 37185008 missense probably damaging 1.00
IGL01843:Pcdha11 APN 18 37012833 missense probably benign 0.28
R1165:Pcdha11 UTSW 18 37007704 intron probably benign
R2422:Pcdha11 UTSW 18 37007272 missense probably damaging 0.99
R2423:Pcdha11 UTSW 18 37007424 missense possibly damaging 0.89
R2508:Pcdha11 UTSW 18 37012854 missense possibly damaging 0.86
R3114:Pcdha11 UTSW 18 37011807 missense probably damaging 1.00
R4173:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R4255:Pcdha11 UTSW 18 37012790 missense probably benign 0.23
R4369:Pcdha11 UTSW 18 37006743 missense possibly damaging 0.70
R4454:Pcdha11 UTSW 18 37007373 missense probably benign 0.13
R4489:Pcdha11 UTSW 18 37006916 missense possibly damaging 0.78
R4626:Pcdha11 UTSW 18 37006998 missense probably damaging 1.00
R4751:Pcdha11 UTSW 18 37006944 missense probably damaging 1.00
R4801:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4802:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4857:Pcdha11 UTSW 18 37011452 missense probably benign 0.02
R4995:Pcdha11 UTSW 18 37011027 missense probably benign 0.24
R5042:Pcdha11 UTSW 18 37011596 missense probably damaging 1.00
R5480:Pcdha11 UTSW 18 37005882 missense probably benign 0.04
R5495:Pcdha11 UTSW 18 37011026 missense probably benign
R5523:Pcdha11 UTSW 18 37012386 missense probably damaging 1.00
R5584:Pcdha11 UTSW 18 37006765 missense probably damaging 1.00
R5682:Pcdha11 UTSW 18 37011449 missense probably damaging 1.00
R5834:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R5842:Pcdha11 UTSW 18 37011284 missense possibly damaging 0.85
R5859:Pcdha11 UTSW 18 37007283 missense probably damaging 1.00
R6110:Pcdha11 UTSW 18 37011456 missense probably damaging 1.00
R6135:Pcdha11 UTSW 18 37005817 missense probably damaging 1.00
R6248:Pcdha11 UTSW 18 37005897 missense probably benign 0.26
R6450:Pcdha11 UTSW 18 37013162 missense probably damaging 1.00
R6594:Pcdha11 UTSW 18 37011182 missense probably benign 0.04
R6631:Pcdha11 UTSW 18 37005791 missense probably damaging 1.00
R6883:Pcdha11 UTSW 18 37011189 missense probably damaging 1.00
R7088:Pcdha11 UTSW 18 37005417 missense probably benign 0.00
R7129:Pcdha11 UTSW 18 37007238 missense probably benign 0.45
R7153:Pcdha11 UTSW 18 37011225 missense probably damaging 1.00
R7244:Pcdha11 UTSW 18 37011368 nonsense probably null
R7295:Pcdha11 UTSW 18 37006926 missense probably damaging 1.00
R7319:Pcdha11 UTSW 18 37013192 missense probably benign 0.10
R7352:Pcdha11 UTSW 18 37006845 missense probably damaging 1.00
R7516:Pcdha11 UTSW 18 37011618 missense probably damaging 1.00
R7519:Pcdha11 UTSW 18 37006266 nonsense probably null
R7660:Pcdha11 UTSW 18 37005851 missense probably benign 0.17
R7677:Pcdha11 UTSW 18 37011552 missense probably damaging 1.00
R7707:Pcdha11 UTSW 18 37011792 missense probably benign 0.00
R7775:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7778:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7780:Pcdha11 UTSW 18 37012796 missense probably damaging 0.97
R8068:Pcdha11 UTSW 18 37005565 missense probably damaging 1.00
R8220:Pcdha11 UTSW 18 37006571 missense probably benign 0.01
R8252:Pcdha11 UTSW 18 37007537 missense possibly damaging 0.65
RF017:Pcdha11 UTSW 18 37005524 missense possibly damaging 0.92
Z1177:Pcdha11 UTSW 18 37012923 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TTCTGGAATCAATGGCCAAGTG -3'
(R):5'- GTGCACAGACACATAGCTCG -3'

Sequencing Primer
(F):5'- TCAATGGCCAAGTGACCTG -3'
(R):5'- ACCCTCCGCTCCACCAG -3'
Posted On2018-05-24