Incidental Mutation 'R6416:Ehbp1l1'
ID517973
Institutional Source Beutler Lab
Gene Symbol Ehbp1l1
Ensembl Gene ENSMUSG00000024937
Gene NameEH domain binding protein 1-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6416 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5707376-5726317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5718757 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 839 (I839M)
Ref Sequence ENSEMBL: ENSMUSP00000037656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049295] [ENSMUST00000075606]
Predicted Effect probably benign
Transcript: ENSMUST00000049295
AA Change: I839M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937
AA Change: I839M

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075606
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to a reduction in the length and density of small intestinal microvilli, severe anemia, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Ehbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Ehbp1l1 APN 19 5717933 missense probably benign 0.33
IGL01061:Ehbp1l1 APN 19 5717888 missense probably benign
IGL01372:Ehbp1l1 APN 19 5715789 splice site probably benign
IGL01790:Ehbp1l1 APN 19 5722984 missense probably damaging 0.99
IGL01936:Ehbp1l1 APN 19 5718249 nonsense probably null
IGL02194:Ehbp1l1 APN 19 5718857 missense probably benign
IGL02347:Ehbp1l1 APN 19 5719572 missense possibly damaging 0.72
IGL02372:Ehbp1l1 APN 19 5710834 missense possibly damaging 0.53
IGL02681:Ehbp1l1 APN 19 5720825 missense probably damaging 0.98
IGL02824:Ehbp1l1 APN 19 5719298 missense probably benign
IGL03070:Ehbp1l1 APN 19 5715953 missense probably benign 0.33
IGL03146:Ehbp1l1 APN 19 5720033 missense probably benign 0.00
PIT4802001:Ehbp1l1 UTSW 19 5719575 missense possibly damaging 0.93
R0309:Ehbp1l1 UTSW 19 5720570 missense possibly damaging 0.72
R0787:Ehbp1l1 UTSW 19 5722668 missense possibly damaging 0.95
R1156:Ehbp1l1 UTSW 19 5708336 unclassified probably benign
R1337:Ehbp1l1 UTSW 19 5718230 missense probably benign 0.00
R1474:Ehbp1l1 UTSW 19 5719084 missense possibly damaging 0.86
R1501:Ehbp1l1 UTSW 19 5716424 missense probably damaging 0.98
R1582:Ehbp1l1 UTSW 19 5721967 missense possibly damaging 0.83
R1766:Ehbp1l1 UTSW 19 5716406 missense probably damaging 0.98
R1838:Ehbp1l1 UTSW 19 5717691 missense probably benign 0.39
R1842:Ehbp1l1 UTSW 19 5725930 missense probably damaging 0.99
R1863:Ehbp1l1 UTSW 19 5717854 missense probably benign 0.01
R1955:Ehbp1l1 UTSW 19 5710669 missense possibly damaging 0.51
R2010:Ehbp1l1 UTSW 19 5719283 missense probably benign
R2098:Ehbp1l1 UTSW 19 5708658 missense possibly damaging 0.93
R2099:Ehbp1l1 UTSW 19 5718401 missense possibly damaging 0.72
R2852:Ehbp1l1 UTSW 19 5716487 missense probably damaging 0.99
R3113:Ehbp1l1 UTSW 19 5718980 missense probably benign 0.38
R3799:Ehbp1l1 UTSW 19 5719115 missense probably benign 0.33
R3891:Ehbp1l1 UTSW 19 5718312 missense possibly damaging 0.73
R3964:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R3966:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R4335:Ehbp1l1 UTSW 19 5708769 missense probably damaging 0.98
R4434:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R4457:Ehbp1l1 UTSW 19 5716293 missense possibly damaging 0.83
R4597:Ehbp1l1 UTSW 19 5717927 missense possibly damaging 0.72
R4726:Ehbp1l1 UTSW 19 5719176 missense possibly damaging 0.70
R4761:Ehbp1l1 UTSW 19 5719847 missense possibly damaging 0.93
R4771:Ehbp1l1 UTSW 19 5725968 missense probably damaging 1.00
R5402:Ehbp1l1 UTSW 19 5716320 missense possibly damaging 0.91
R5436:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R5602:Ehbp1l1 UTSW 19 5708670 missense possibly damaging 0.85
R5893:Ehbp1l1 UTSW 19 5718431 missense probably benign
R6329:Ehbp1l1 UTSW 19 5718767 missense possibly damaging 0.53
R7106:Ehbp1l1 UTSW 19 5718737 missense probably benign 0.33
R7262:Ehbp1l1 UTSW 19 5718446 nonsense probably null
R7304:Ehbp1l1 UTSW 19 5716382 missense probably damaging 1.00
R7317:Ehbp1l1 UTSW 19 5720702 missense probably benign 0.44
R7404:Ehbp1l1 UTSW 19 5720844 missense possibly damaging 0.72
R7447:Ehbp1l1 UTSW 19 5719428 missense possibly damaging 0.53
R7862:Ehbp1l1 UTSW 19 5720823 missense probably benign
R7881:Ehbp1l1 UTSW 19 5719398 missense probably benign
R7910:Ehbp1l1 UTSW 19 5716424 missense probably benign 0.28
R8239:Ehbp1l1 UTSW 19 5720061 missense possibly damaging 0.53
R8309:Ehbp1l1 UTSW 19 5717075 missense probably damaging 1.00
RF053:Ehbp1l1 UTSW 19 5716002 small deletion probably benign
Z1088:Ehbp1l1 UTSW 19 5716287 missense possibly damaging 0.77
Z1176:Ehbp1l1 UTSW 19 5717889 missense probably benign
Z1177:Ehbp1l1 UTSW 19 5718762 missense probably damaging 0.99
Z1177:Ehbp1l1 UTSW 19 5719101 missense probably benign 0.07
Z1177:Ehbp1l1 UTSW 19 5719102 missense probably benign 0.01
Z1177:Ehbp1l1 UTSW 19 5719434 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGTCCCTAAGAGCTCAGATTC -3'
(R):5'- GGAGACCGATGTTTCAGTGATG -3'

Sequencing Primer
(F):5'- CCCTAAGAGCTCAGATTCTGGTAG -3'
(R):5'- ACCGATGTTTCAGTGATGGAGAC -3'
Posted On2018-05-24