Incidental Mutation 'R6416:Sorcs3'
ID517974
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Namesortilin-related VPS10 domain containing receptor 3
Synonyms6330404A12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6416 (G1)
Quality Score211.009
Status Validated
Chromosome19
Chromosomal Location48206025-48805505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48802759 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1182 (F1182S)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
Predicted Effect probably damaging
Transcript: ENSMUST00000078880
AA Change: F1182S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: F1182S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48683658 critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48748319 missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48603864 missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48767103 missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48796375 missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48790131 missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48794168 missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48535531 missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48654072 missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48704370 splice site probably benign
IGL02830:Sorcs3 APN 19 48723002 splice site probably null
IGL02943:Sorcs3 APN 19 48759938 missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48603894 missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48654044 missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48748319 missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48797517 critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48802698 nonsense probably null
R0646:Sorcs3 UTSW 19 48206295 missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48487406 missense probably benign
R0792:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48693994 missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48487394 missense probably benign
R1253:Sorcs3 UTSW 19 48206736 missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48694001 critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48764181 missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48748359 critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48603875 missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48794274 missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48722925 missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48398711 missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48603904 missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48722956 missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48749373 missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48693914 missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48683597 missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48794163 missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48764148 missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48759951 missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48759845 critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48796472 splice site probably null
R5848:Sorcs3 UTSW 19 48788511 missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48749396 missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48796450 missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48398697 missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48759857 missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48790166 missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48764307 critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48788505 missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48713571 missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48693824 missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48749343 missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48705963 missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48772266 missense possibly damaging 0.69
R8043:Sorcs3 UTSW 19 48764295 missense possibly damaging 0.84
X0018:Sorcs3 UTSW 19 48772289 missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48645804 missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48704300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTGGCTGTTCCCTTTAATAC -3'
(R):5'- GAAGAGTATGTCACTGTAGGCAAC -3'

Sequencing Primer
(F):5'- TCCCAGGACATCTTATTACCCAC -3'
(R):5'- GAGTATGTCACTGTAGGCAACTTTCC -3'
Posted On2018-05-24