Incidental Mutation 'R6416:Sorcs3'
ID 517974
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
MMRRC Submission 044558-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R6416 (G1)
Quality Score 211.009
Status Validated
Chromosome 19
Chromosomal Location 48194464-48793944 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48791198 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1182 (F1182S)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect probably damaging
Transcript: ENSMUST00000078880
AA Change: F1182S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: F1182S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Meta Mutation Damage Score 0.4098 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,504,779 (GRCm39) R6L unknown Het
Anxa11 A G 14: 25,874,694 (GRCm39) Q235R possibly damaging Het
Ap2b1 T A 11: 83,199,065 (GRCm39) M1K probably null Het
Atl2 G A 17: 80,157,652 (GRCm39) T563I probably benign Het
Azin1 A T 15: 38,492,587 (GRCm39) S307R possibly damaging Het
Ccdc153 A G 9: 44,157,077 (GRCm39) T118A probably benign Het
Chac1 G A 2: 119,184,015 (GRCm39) V206I probably damaging Het
Chrm3 A G 13: 9,927,698 (GRCm39) V446A probably benign Het
Cped1 T C 6: 22,123,648 (GRCm39) F467S probably damaging Het
Csmd3 G A 15: 48,536,956 (GRCm39) P82L probably damaging Het
Ddx60 T A 8: 62,430,984 (GRCm39) S840T probably benign Het
Ddx60 C T 8: 62,451,715 (GRCm39) H1202Y probably benign Het
Dnah8 T A 17: 30,984,609 (GRCm39) N3102K probably benign Het
Dst A T 1: 34,155,209 (GRCm39) K85M probably damaging Het
Ehbp1l1 T C 19: 5,768,785 (GRCm39) I839M probably benign Het
Fam184b T A 5: 45,694,995 (GRCm39) M750L probably benign Het
Frem2 T C 3: 53,479,799 (GRCm39) T1965A probably benign Het
Ftl1 A T 7: 45,108,634 (GRCm39) D41E probably benign Het
Garem2 G A 5: 30,321,735 (GRCm39) W698* probably null Het
Glt8d2 T C 10: 82,488,740 (GRCm39) Y283C probably damaging Het
Hars1 T C 18: 36,906,643 (GRCm39) E109G possibly damaging Het
Hspb9 T C 11: 100,605,036 (GRCm39) S121P probably damaging Het
Hus1b A T 13: 31,131,188 (GRCm39) L157Q probably damaging Het
Hykk A G 9: 54,853,643 (GRCm39) M322V probably benign Het
Igkv4-61 C A 6: 69,394,138 (GRCm39) A31S possibly damaging Het
Il17f T A 1: 20,848,131 (GRCm39) M116L probably benign Het
Kif22 T C 7: 126,628,104 (GRCm39) K9E possibly damaging Het
Krt90 T C 15: 101,467,679 (GRCm39) E233G probably benign Het
Lipg T C 18: 75,090,307 (GRCm39) M81V probably benign Het
Mocos C T 18: 24,834,513 (GRCm39) S850L probably damaging Het
Mug2 T A 6: 122,059,713 (GRCm39) S1364T probably damaging Het
Neb A T 2: 52,075,340 (GRCm39) N208K probably benign Het
Oca2 G T 7: 55,978,515 (GRCm39) R561L probably benign Het
Olfm5 A G 7: 103,803,260 (GRCm39) L401P probably damaging Het
Or12d17 T A 17: 37,777,971 (GRCm39) Y291* probably null Het
Or2t49 T C 11: 58,393,166 (GRCm39) D72G probably damaging Het
Or4a39 C A 2: 89,236,866 (GRCm39) A186S possibly damaging Het
Or7g16 G A 9: 18,727,188 (GRCm39) T134M probably benign Het
Or8g33 T A 9: 39,338,187 (GRCm39) Y60F probably damaging Het
Oxgr1 T C 14: 120,259,860 (GRCm39) N116D probably damaging Het
Pcdha11 G T 18: 37,145,222 (GRCm39) probably null Het
Pi4ka T C 16: 17,176,186 (GRCm39) I418V probably benign Het
Pih1d2 T C 9: 50,529,909 (GRCm39) V62A probably benign Het
Pkib T A 10: 57,604,234 (GRCm39) V46E probably damaging Het
Pum1 A G 4: 130,455,598 (GRCm39) probably null Het
Rbak G T 5: 143,162,307 (GRCm39) Q19K possibly damaging Het
Sema3c A G 5: 17,781,959 (GRCm39) T32A probably damaging Het
Shprh T C 10: 11,043,617 (GRCm39) W835R probably damaging Het
Sis T G 3: 72,819,187 (GRCm39) K1456N probably damaging Het
Slc4a4 A T 5: 89,327,588 (GRCm39) N675I probably benign Het
Slc8a3 C A 12: 81,362,401 (GRCm39) M139I probably damaging Het
St8sia2 A T 7: 73,621,669 (GRCm39) I96N probably damaging Het
Stx19 T C 16: 62,642,420 (GRCm39) S79P probably damaging Het
Tecta C T 9: 42,286,563 (GRCm39) V698M probably damaging Het
Timm22 T C 11: 76,301,965 (GRCm39) S150P probably damaging Het
Tjp1 C T 7: 64,962,953 (GRCm39) D995N possibly damaging Het
Tmem135 T A 7: 88,797,002 (GRCm39) T365S probably benign Het
Tmem174 T C 13: 98,773,489 (GRCm39) T114A probably benign Het
Tnc A G 4: 63,926,053 (GRCm39) I909T probably benign Het
Trcg1 A G 9: 57,148,613 (GRCm39) I62V possibly damaging Het
Tulp1 A T 17: 28,575,005 (GRCm39) *487K probably null Het
Unc79 T A 12: 103,097,905 (GRCm39) V1826E possibly damaging Het
Vmn2r13 A T 5: 109,321,982 (GRCm39) N238K probably damaging Het
Vmn2r22 T A 6: 123,614,697 (GRCm39) N298Y probably damaging Het
Vmn2r23 T A 6: 123,689,861 (GRCm39) F246I probably damaging Het
Vps9d1 A C 8: 123,975,378 (GRCm39) V194G probably damaging Het
Zfp260 A T 7: 29,804,235 (GRCm39) H45L possibly damaging Het
Zfp846 A T 9: 20,505,016 (GRCm39) H292L possibly damaging Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,672,097 (GRCm39) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,736,758 (GRCm39) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,592,303 (GRCm39) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,755,542 (GRCm39) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,784,814 (GRCm39) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,778,570 (GRCm39) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,782,607 (GRCm39) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,523,970 (GRCm39) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,642,511 (GRCm39) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,692,809 (GRCm39) splice site probably benign
IGL02830:Sorcs3 APN 19 48,711,441 (GRCm39) splice site probably null
IGL02943:Sorcs3 APN 19 48,748,377 (GRCm39) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,592,333 (GRCm39) missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48,642,483 (GRCm39) missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48,736,758 (GRCm39) missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48,785,956 (GRCm39) critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48,791,137 (GRCm39) nonsense probably null
R0646:Sorcs3 UTSW 19 48,194,734 (GRCm39) missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48,475,845 (GRCm39) missense probably benign
R0792:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48,682,433 (GRCm39) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,475,833 (GRCm39) missense probably benign
R1253:Sorcs3 UTSW 19 48,195,175 (GRCm39) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,682,440 (GRCm39) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,752,620 (GRCm39) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,736,798 (GRCm39) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,592,314 (GRCm39) missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48,782,713 (GRCm39) missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,387,150 (GRCm39) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,592,343 (GRCm39) missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48,711,395 (GRCm39) missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,737,812 (GRCm39) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,682,353 (GRCm39) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,672,036 (GRCm39) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,782,602 (GRCm39) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,752,587 (GRCm39) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,748,390 (GRCm39) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,748,284 (GRCm39) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,784,911 (GRCm39) splice site probably null
R5848:Sorcs3 UTSW 19 48,776,950 (GRCm39) missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48,737,835 (GRCm39) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,784,889 (GRCm39) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,387,136 (GRCm39) missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48,748,296 (GRCm39) missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48,778,605 (GRCm39) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,752,746 (GRCm39) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,776,944 (GRCm39) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,702,010 (GRCm39) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,682,263 (GRCm39) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,737,782 (GRCm39) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,694,402 (GRCm39) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,760,705 (GRCm39) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,692,808 (GRCm39) splice site probably null
R8433:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,784,908 (GRCm39) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,737,810 (GRCm39) nonsense probably null
R9051:Sorcs3 UTSW 19 48,194,809 (GRCm39) missense probably benign
R9119:Sorcs3 UTSW 19 48,642,433 (GRCm39) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,784,811 (GRCm39) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,785,950 (GRCm39) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,711,363 (GRCm39) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,760,728 (GRCm39) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,634,243 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,692,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTGGCTGTTCCCTTTAATAC -3'
(R):5'- GAAGAGTATGTCACTGTAGGCAAC -3'

Sequencing Primer
(F):5'- TCCCAGGACATCTTATTACCCAC -3'
(R):5'- GAGTATGTCACTGTAGGCAACTTTCC -3'
Posted On 2018-05-24