Incidental Mutation 'R6419:Rgsl1'
ID517983
Institutional Source Beutler Lab
Gene Symbol Rgsl1
Ensembl Gene ENSMUSG00000042641
Gene Nameregulator of G-protein signaling like 1
SynonymsRgsl2, 4930415K13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6419 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location153779381-153844142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 153822371 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 478 (V478M)
Ref Sequence ENSEMBL: ENSMUSP00000135642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]
Predicted Effect probably damaging
Transcript: ENSMUST00000124558
AA Change: V478M

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: V478M

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134030
Predicted Effect unknown
Transcript: ENSMUST00000184095
AA Change: V11M
Predicted Effect probably benign
Transcript: ENSMUST00000185164
AA Change: V513M

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: V513M

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T C 4: 42,812,473 probably benign Het
Abcc2 T A 19: 43,837,508 probably null Het
Adamts12 C T 15: 11,215,673 T260M possibly damaging Het
Adamts20 C T 15: 94,333,675 V878I possibly damaging Het
Adgrl4 A G 3: 151,439,316 E34G probably damaging Het
Asah1 A T 8: 41,343,766 I293N probably damaging Het
B3galt2 A T 1: 143,647,101 E325V possibly damaging Het
Baz1b T A 5: 135,242,494 H1310Q probably benign Het
Ccdc125 T A 13: 100,690,326 N204K probably damaging Het
Cd36 C T 5: 17,797,152 D284N probably benign Het
Cdh12 T C 15: 21,520,397 L316S probably damaging Het
Cenpv T C 11: 62,525,182 K247R probably benign Het
Cldn18 T C 9: 99,692,748 H257R possibly damaging Het
Cnot8 T A 11: 58,114,065 Y197N probably damaging Het
Cog3 A T 14: 75,724,738 C554* probably null Het
Col4a4 A G 1: 82,466,486 probably null Het
Cops5 G A 1: 10,033,307 T158I probably damaging Het
Dhh A G 15: 98,894,401 F242S probably damaging Het
Dot1l T C 10: 80,791,481 V1512A possibly damaging Het
Dstn T G 2: 143,939,987 I116S possibly damaging Het
Egfem1 G A 3: 29,657,249 D326N probably damaging Het
Enpp3 A T 10: 24,808,191 Y52N probably damaging Het
Fam214a G A 9: 75,009,337 S413N probably benign Het
Gabra2 A G 5: 70,962,083 S359P probably benign Het
Gbp7 G A 3: 142,546,453 G599E probably benign Het
Gcat T G 15: 79,036,064 I198S probably damaging Het
Gm8439 A G 4: 120,609,558 K82R unknown Het
Grin2b A G 6: 135,740,967 F709S probably damaging Het
Grm3 T C 5: 9,570,201 N348D probably damaging Het
Hdgfl1 G A 13: 26,770,092 probably benign Het
Hmgxb3 G T 18: 61,152,224 D564E possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Impg1 A G 9: 80,380,018 V305A probably benign Het
Ints7 T A 1: 191,602,302 S313T possibly damaging Het
Knl1 T A 2: 119,069,003 I395K probably benign Het
Lactb2 A T 1: 13,638,235 Y196* probably null Het
Lad1 T C 1: 135,831,892 S509P possibly damaging Het
Ltf T C 9: 111,031,022 F504L possibly damaging Het
Med4 A T 14: 73,513,923 D104V probably damaging Het
Mrpl58 A T 11: 115,410,247 N128Y probably damaging Het
Ndufs2 T C 1: 171,241,099 T54A probably benign Het
Notch2 G T 3: 98,100,389 probably null Het
Ntng1 A T 3: 109,782,853 N424K possibly damaging Het
Ntrk2 G A 13: 58,861,299 W301* probably null Het
Olfr1471 T A 19: 13,445,767 S252T probably benign Het
Otud6b A G 4: 14,822,766 S113P possibly damaging Het
Papd7 A C 13: 69,510,666 M350R possibly damaging Het
Pcdhb20 A G 18: 37,505,555 N378S probably damaging Het
Polr3b T C 10: 84,638,111 S185P possibly damaging Het
Ptprn G A 1: 75,264,037 R31C probably benign Het
Sema6b A T 17: 56,132,784 L19* probably null Het
Slfn8 A G 11: 83,004,055 probably null Het
Spen A T 4: 141,476,310 S1669T unknown Het
Syne2 T C 12: 76,096,966 F1522L probably damaging Het
Tarbp1 C T 8: 126,459,044 A470T possibly damaging Het
Tiam1 C A 16: 89,898,024 E182* probably null Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trip12 C T 1: 84,793,870 A186T probably damaging Het
Ufc1 C T 1: 171,288,956 A147T probably damaging Het
Vmn1r199 A G 13: 22,383,607 K314R possibly damaging Het
Vmn2r13 A T 5: 109,175,219 I68K possibly damaging Het
Vmn2r77 A T 7: 86,811,559 I698F probably damaging Het
Vmn2r86 T C 10: 130,446,926 K607R probably damaging Het
Vwa3b T C 1: 37,157,376 V28A probably benign Het
Wdr19 A G 5: 65,215,893 N166S possibly damaging Het
Wfdc17 G A 11: 83,704,808 G33R probably damaging Het
Zfp330 T G 8: 82,764,916 K209N probably benign Het
Zfp493 A G 13: 67,786,407 T160A probably benign Het
Zfp974 A T 7: 27,911,515 C262S possibly damaging Het
Other mutations in Rgsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Rgsl1 APN 1 153826141 missense probably damaging 1.00
IGL02253:Rgsl1 APN 1 153793767 missense probably damaging 1.00
IGL02345:Rgsl1 APN 1 153804009 splice site probably null
IGL02409:Rgsl1 APN 1 153826243 missense possibly damaging 0.53
IGL02587:Rgsl1 APN 1 153799938 missense probably damaging 1.00
IGL02652:Rgsl1 APN 1 153825490 missense probably damaging 1.00
IGL02797:Rgsl1 APN 1 153807708 missense probably damaging 1.00
IGL03032:Rgsl1 APN 1 153826202 missense possibly damaging 0.53
IGL03082:Rgsl1 APN 1 153799947 missense possibly damaging 0.86
IGL03123:Rgsl1 APN 1 153825941 missense probably damaging 1.00
IGL03213:Rgsl1 APN 1 153825841 missense probably benign 0.12
IGL03410:Rgsl1 APN 1 153793755 missense probably null 0.82
IGL03050:Rgsl1 UTSW 1 153825676 missense possibly damaging 0.60
PIT4519001:Rgsl1 UTSW 1 153825970 missense possibly damaging 0.96
R0149:Rgsl1 UTSW 1 153793764 missense probably damaging 1.00
R0536:Rgsl1 UTSW 1 153826181 missense probably damaging 1.00
R0633:Rgsl1 UTSW 1 153844107 missense possibly damaging 0.72
R0726:Rgsl1 UTSW 1 153802328 missense probably damaging 1.00
R0839:Rgsl1 UTSW 1 153802234 critical splice donor site probably null
R1240:Rgsl1 UTSW 1 153785191 missense probably benign 0.18
R1355:Rgsl1 UTSW 1 153807761 start codon destroyed probably null 0.23
R1491:Rgsl1 UTSW 1 153825926 missense possibly damaging 0.93
R1688:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1694:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1842:Rgsl1 UTSW 1 153799797 missense probably damaging 1.00
R2008:Rgsl1 UTSW 1 153825905 missense possibly damaging 0.53
R2114:Rgsl1 UTSW 1 153817549 missense probably benign
R2116:Rgsl1 UTSW 1 153817549 missense probably benign
R2176:Rgsl1 UTSW 1 153825268 splice site probably benign
R2229:Rgsl1 UTSW 1 153822358 missense possibly damaging 0.72
R2895:Rgsl1 UTSW 1 153827548 missense probably damaging 1.00
R3923:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R4001:Rgsl1 UTSW 1 153817584 missense probably damaging 1.00
R4434:Rgsl1 UTSW 1 153802341 missense possibly damaging 0.52
R4489:Rgsl1 UTSW 1 153827536 missense probably benign 0.27
R4649:Rgsl1 UTSW 1 153817582 missense probably benign 0.01
R4925:Rgsl1 UTSW 1 153812277 missense probably benign 0.01
R4928:Rgsl1 UTSW 1 153793768 missense probably damaging 1.00
R5045:Rgsl1 UTSW 1 153821522 nonsense probably null
R5304:Rgsl1 UTSW 1 153827492 missense probably damaging 0.97
R5331:Rgsl1 UTSW 1 153802292 missense probably benign 0.02
R5373:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5374:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5566:Rgsl1 UTSW 1 153793774 missense probably damaging 1.00
R5649:Rgsl1 UTSW 1 153825893 missense possibly damaging 0.93
R6062:Rgsl1 UTSW 1 153799872 missense possibly damaging 0.72
R6142:Rgsl1 UTSW 1 153812238 missense probably benign 0.01
R6158:Rgsl1 UTSW 1 153804021 missense possibly damaging 0.72
R6184:Rgsl1 UTSW 1 153827448 missense probably benign 0.08
R6273:Rgsl1 UTSW 1 153827465 missense possibly damaging 0.96
R6384:Rgsl1 UTSW 1 153827545 missense possibly damaging 0.86
R6568:Rgsl1 UTSW 1 153821546 missense possibly damaging 0.72
R6660:Rgsl1 UTSW 1 153825766 missense possibly damaging 0.70
R6745:Rgsl1 UTSW 1 153822317 missense probably benign 0.18
R6892:Rgsl1 UTSW 1 153821499 nonsense probably null
R6974:Rgsl1 UTSW 1 153799822 missense probably damaging 1.00
R7172:Rgsl1 UTSW 1 153826220 missense possibly damaging 0.72
R7200:Rgsl1 UTSW 1 153785199 missense probably benign 0.33
R7275:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R7313:Rgsl1 UTSW 1 153807876 critical splice acceptor site probably null
R7341:Rgsl1 UTSW 1 153793845 missense probably benign 0.01
R7448:Rgsl1 UTSW 1 153844101 critical splice donor site probably null
R7662:Rgsl1 UTSW 1 153825479 missense probably benign
R7703:Rgsl1 UTSW 1 153793864 missense possibly damaging 0.73
R7846:Rgsl1 UTSW 1 153826037 missense possibly damaging 0.53
X0020:Rgsl1 UTSW 1 153825385 missense probably benign 0.33
X0065:Rgsl1 UTSW 1 153804033 missense possibly damaging 0.84
Z1177:Rgsl1 UTSW 1 153817610 missense possibly damaging 0.70
Z1177:Rgsl1 UTSW 1 153825988 missense not run
Predicted Primers PCR Primer
(F):5'- CTGCTGTCTCCAGGAAGAAG -3'
(R):5'- CCATTTTCTGATGCTTATAGAGGGG -3'

Sequencing Primer
(F):5'- GTCTCCAGGAAGAAGTCTTAATTTC -3'
(R):5'- CTGATGCTTATAGAGGGGCTATG -3'
Posted On2018-05-24