Incidental Mutation 'R6419:Asah1'
ID 518006
Institutional Source Beutler Lab
Gene Symbol Asah1
Ensembl Gene ENSMUSG00000031591
Gene Name N-acylsphingosine amidohydrolase 1
Synonyms 2310081N20Rik, acid ceramidase
MMRRC Submission 044561-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6419 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 41793234-41827810 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41796803 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 293 (I293N)
Ref Sequence ENSEMBL: ENSMUSP00000034000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034000] [ENSMUST00000110417]
AlphaFold Q9WV54
Predicted Effect probably damaging
Transcript: ENSMUST00000034000
AA Change: I293N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034000
Gene: ENSMUSG00000031591
AA Change: I293N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NAAA-beta 44 138 4.2e-35 PFAM
Pfam:CBAH 142 389 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110417
SMART Domains Protein: ENSMUSP00000106047
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
Pfam:NAAA-beta 24 118 8.8e-39 PFAM
Pfam:CBAH 122 216 7.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131796
Meta Mutation Damage Score 0.9623 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: This gene encodes acid ceramidase, an enzyme that plays a central role in ceramide metabolism. The encoded protein undergoes proteolytic processing to generate a heterodimeric enzyme comprised of alpha and beta subunits that catalyzes the hydrolysis of sphingolipid ceramide into sphingosine and free fatty acid. The homozygous disruption of this gene leads to embryonic lethality in mice whereas the heterozygous animals exhibit a progressive lipid storage disease phenotype. [provided by RefSeq, Oct 2015]
PHENOTYPE: Nullizygous mutation of this gene causes embryonic lethality. Homozygotes for the P361R mutation die prematurely with growth defects, low acid ceramidase activity, high ceramide levels, histiocyte infiltrates into various organs, Farber bodies, short femur growth plates and altered ovary morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T C 4: 42,812,473 (GRCm39) probably benign Het
Abcc2 T A 19: 43,825,947 (GRCm39) probably null Het
Adamts12 C T 15: 11,215,759 (GRCm39) T260M possibly damaging Het
Adamts20 C T 15: 94,231,556 (GRCm39) V878I possibly damaging Het
Adgrl4 A G 3: 151,144,953 (GRCm39) E34G probably damaging Het
Atosa G A 9: 74,916,619 (GRCm39) S413N probably benign Het
B3galt2 A T 1: 143,522,839 (GRCm39) E325V possibly damaging Het
Baz1b T A 5: 135,271,348 (GRCm39) H1310Q probably benign Het
Ccdc125 T A 13: 100,826,834 (GRCm39) N204K probably damaging Het
Cd36 C T 5: 18,002,150 (GRCm39) D284N probably benign Het
Cdh12 T C 15: 21,520,483 (GRCm39) L316S probably damaging Het
Cenpv T C 11: 62,416,008 (GRCm39) K247R probably benign Het
Cldn18 T C 9: 99,574,801 (GRCm39) H257R possibly damaging Het
Cnot8 T A 11: 58,004,891 (GRCm39) Y197N probably damaging Het
Cog3 A T 14: 75,962,178 (GRCm39) C554* probably null Het
Col4a4 A G 1: 82,444,207 (GRCm39) probably null Het
Cops5 G A 1: 10,103,532 (GRCm39) T158I probably damaging Het
Dhh A G 15: 98,792,282 (GRCm39) F242S probably damaging Het
Dot1l T C 10: 80,627,315 (GRCm39) V1512A possibly damaging Het
Dstn T G 2: 143,781,907 (GRCm39) I116S possibly damaging Het
Egfem1 G A 3: 29,711,398 (GRCm39) D326N probably damaging Het
Enpp3 A T 10: 24,684,089 (GRCm39) Y52N probably damaging Het
Gabra2 A G 5: 71,119,426 (GRCm39) S359P probably benign Het
Gbp7 G A 3: 142,252,214 (GRCm39) G599E probably benign Het
Gcat T G 15: 78,920,264 (GRCm39) I198S probably damaging Het
Gm8439 A G 4: 120,466,755 (GRCm39) K82R unknown Het
Grin2b A G 6: 135,717,965 (GRCm39) F709S probably damaging Het
Grm3 T C 5: 9,620,201 (GRCm39) N348D probably damaging Het
Hdgfl1 G A 13: 26,954,075 (GRCm39) probably benign Het
Hmgxb3 G T 18: 61,285,296 (GRCm39) D564E possibly damaging Het
Igkv4-61 C A 6: 69,394,138 (GRCm39) A31S possibly damaging Het
Impg1 A G 9: 80,287,300 (GRCm39) V305A probably benign Het
Ints7 T A 1: 191,334,414 (GRCm39) S313T possibly damaging Het
Knl1 T A 2: 118,899,484 (GRCm39) I395K probably benign Het
Lactb2 A T 1: 13,708,459 (GRCm39) Y196* probably null Het
Lad1 T C 1: 135,759,630 (GRCm39) S509P possibly damaging Het
Ltf T C 9: 110,860,090 (GRCm39) F504L possibly damaging Het
Med4 A T 14: 73,751,363 (GRCm39) D104V probably damaging Het
Mrpl58 A T 11: 115,301,073 (GRCm39) N128Y probably damaging Het
Ndufs2 T C 1: 171,068,668 (GRCm39) T54A probably benign Het
Notch2 G T 3: 98,007,705 (GRCm39) probably null Het
Ntng1 A T 3: 109,690,169 (GRCm39) N424K possibly damaging Het
Ntrk2 G A 13: 59,009,113 (GRCm39) W301* probably null Het
Or5b116 T A 19: 13,423,131 (GRCm39) S252T probably benign Het
Otud6b A G 4: 14,822,766 (GRCm39) S113P possibly damaging Het
Pcdhb20 A G 18: 37,638,608 (GRCm39) N378S probably damaging Het
Polr3b T C 10: 84,473,975 (GRCm39) S185P possibly damaging Het
Ptprn G A 1: 75,240,681 (GRCm39) R31C probably benign Het
Rgsl1 C T 1: 153,698,117 (GRCm39) V478M probably damaging Het
Sema6b A T 17: 56,439,784 (GRCm39) L19* probably null Het
Slfn8 A G 11: 82,894,881 (GRCm39) probably null Het
Spen A T 4: 141,203,621 (GRCm39) S1669T unknown Het
Syne2 T C 12: 76,143,740 (GRCm39) F1522L probably damaging Het
Tarbp1 C T 8: 127,185,783 (GRCm39) A470T possibly damaging Het
Tent4a A C 13: 69,658,785 (GRCm39) M350R possibly damaging Het
Tiam1 C A 16: 89,694,912 (GRCm39) E182* probably null Het
Tmem231 G A 8: 112,653,524 (GRCm39) probably benign Het
Trip12 C T 1: 84,771,591 (GRCm39) A186T probably damaging Het
Ufc1 C T 1: 171,116,529 (GRCm39) A147T probably damaging Het
Vmn1r199 A G 13: 22,567,777 (GRCm39) K314R possibly damaging Het
Vmn2r13 A T 5: 109,323,085 (GRCm39) I68K possibly damaging Het
Vmn2r77 A T 7: 86,460,767 (GRCm39) I698F probably damaging Het
Vmn2r86 T C 10: 130,282,795 (GRCm39) K607R probably damaging Het
Vwa3b T C 1: 37,196,457 (GRCm39) V28A probably benign Het
Wdr19 A G 5: 65,373,236 (GRCm39) N166S possibly damaging Het
Wfdc17 G A 11: 83,595,634 (GRCm39) G33R probably damaging Het
Zfp330 T G 8: 83,491,545 (GRCm39) K209N probably benign Het
Zfp493 A G 13: 67,934,526 (GRCm39) T160A probably benign Het
Zfp974 A T 7: 27,610,940 (GRCm39) C262S possibly damaging Het
Other mutations in Asah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Asah1 APN 8 41,802,580 (GRCm39) unclassified probably benign
IGL02512:Asah1 APN 8 41,813,344 (GRCm39) intron probably benign
IGL02523:Asah1 APN 8 41,804,984 (GRCm39) missense probably benign
IGL03115:Asah1 APN 8 41,813,336 (GRCm39) missense possibly damaging 0.94
IGL03357:Asah1 APN 8 41,799,233 (GRCm39) splice site probably benign
PIT4366001:Asah1 UTSW 8 41,796,783 (GRCm39) missense possibly damaging 0.94
R0593:Asah1 UTSW 8 41,802,619 (GRCm39) missense probably benign 0.02
R1451:Asah1 UTSW 8 41,807,049 (GRCm39) critical splice donor site probably null
R1977:Asah1 UTSW 8 41,796,554 (GRCm39) critical splice donor site probably null
R2200:Asah1 UTSW 8 41,796,765 (GRCm39) critical splice donor site probably null
R3429:Asah1 UTSW 8 41,804,925 (GRCm39) unclassified probably benign
R4002:Asah1 UTSW 8 41,801,176 (GRCm39) splice site probably benign
R4078:Asah1 UTSW 8 41,807,119 (GRCm39) missense probably damaging 0.99
R4470:Asah1 UTSW 8 41,796,761 (GRCm39) splice site probably null
R4471:Asah1 UTSW 8 41,796,761 (GRCm39) splice site probably null
R4968:Asah1 UTSW 8 41,807,067 (GRCm39) missense
R4970:Asah1 UTSW 8 41,813,314 (GRCm39) nonsense probably null
R5643:Asah1 UTSW 8 41,813,332 (GRCm39) missense possibly damaging 0.94
R5644:Asah1 UTSW 8 41,813,332 (GRCm39) missense possibly damaging 0.94
R6128:Asah1 UTSW 8 41,807,092 (GRCm39) missense probably damaging 1.00
R7059:Asah1 UTSW 8 41,800,106 (GRCm39) missense probably damaging 0.96
R7442:Asah1 UTSW 8 41,796,602 (GRCm39) missense possibly damaging 0.60
R7587:Asah1 UTSW 8 41,827,578 (GRCm39) missense probably benign 0.43
R7663:Asah1 UTSW 8 41,794,664 (GRCm39) missense probably damaging 0.98
R7980:Asah1 UTSW 8 41,807,067 (GRCm39) missense
R8122:Asah1 UTSW 8 41,796,767 (GRCm39) missense probably benign 0.01
R8275:Asah1 UTSW 8 41,801,159 (GRCm39) missense probably damaging 1.00
R8700:Asah1 UTSW 8 41,813,312 (GRCm39) missense probably benign 0.03
R8752:Asah1 UTSW 8 41,813,314 (GRCm39) missense possibly damaging 0.47
R8960:Asah1 UTSW 8 41,800,061 (GRCm39) missense probably damaging 1.00
R9131:Asah1 UTSW 8 41,807,049 (GRCm39) critical splice donor site probably null
R9539:Asah1 UTSW 8 41,827,584 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCTGCGGTCATCAATAAACAAG -3'
(R):5'- AAGGACTGCTGATACCTGTTTCC -3'

Sequencing Primer
(F):5'- GTGTTTTTCCACCTGTCATAATTGG -3'
(R):5'- GACTGCTGATACCTGTTTCCCTTTAG -3'
Posted On 2018-05-24