Mutagenetix > Incidental Mutation

Incidental Mutation 'R6419:Enpp3'

518013

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R6419 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24808191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 52 (Y52N)

Ref Sequence

ENSEMBL: ENSMUSP00000151371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000219342]

AlphaFold

Q6DYE8

Predicted Effect

probably damaging
Transcript: ENSMUST00000020169
AA Change: Y217N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: Y217N

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000217903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218619

Predicted Effect

probably damaging
Transcript: ENSMUST00000219342
AA Change: Y52N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.3%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578G10Rik	T	C	4: 42,812,473		probably benign	Het
Abcc2	T	A	19: 43,837,508		probably null	Het
Adamts12	C	T	15: 11,215,673	T260M	possibly damaging	Het
Adamts20	C	T	15: 94,333,675	V878I	possibly damaging	Het
Adgrl4	A	G	3: 151,439,316	E34G	probably damaging	Het
Asah1	A	T	8: 41,343,766	I293N	probably damaging	Het
B3galt2	A	T	1: 143,647,101	E325V	possibly damaging	Het
Baz1b	T	A	5: 135,242,494	H1310Q	probably benign	Het
Ccdc125	T	A	13: 100,690,326	N204K	probably damaging	Het
Cd36	C	T	5: 17,797,152	D284N	probably benign	Het
Cdh12	T	C	15: 21,520,397	L316S	probably damaging	Het
Cenpv	T	C	11: 62,525,182	K247R	probably benign	Het
Cldn18	T	C	9: 99,692,748	H257R	possibly damaging	Het
Cnot8	T	A	11: 58,114,065	Y197N	probably damaging	Het
Cog3	A	T	14: 75,724,738	C554*	probably null	Het
Col4a4	A	G	1: 82,466,486		probably null	Het
Cops5	G	A	1: 10,033,307	T158I	probably damaging	Het
Dhh	A	G	15: 98,894,401	F242S	probably damaging	Het
Dot1l	T	C	10: 80,791,481	V1512A	possibly damaging	Het
Dstn	T	G	2: 143,939,987	I116S	possibly damaging	Het
Egfem1	G	A	3: 29,657,249	D326N	probably damaging	Het
Fam214a	G	A	9: 75,009,337	S413N	probably benign	Het
Gabra2	A	G	5: 70,962,083	S359P	probably benign	Het
Gbp7	G	A	3: 142,546,453	G599E	probably benign	Het
Gcat	T	G	15: 79,036,064	I198S	probably damaging	Het
Gm8439	A	G	4: 120,609,558	K82R	unknown	Het
Grin2b	A	G	6: 135,740,967	F709S	probably damaging	Het
Grm3	T	C	5: 9,570,201	N348D	probably damaging	Het
Hdgfl1	G	A	13: 26,770,092		probably benign	Het
Hmgxb3	G	T	18: 61,152,224	D564E	possibly damaging	Het
Igkv4-61	C	A	6: 69,417,154	A31S	possibly damaging	Het
Impg1	A	G	9: 80,380,018	V305A	probably benign	Het
Ints7	T	A	1: 191,602,302	S313T	possibly damaging	Het
Knl1	T	A	2: 119,069,003	I395K	probably benign	Het
Lactb2	A	T	1: 13,638,235	Y196*	probably null	Het
Lad1	T	C	1: 135,831,892	S509P	possibly damaging	Het
Ltf	T	C	9: 111,031,022	F504L	possibly damaging	Het
Med4	A	T	14: 73,513,923	D104V	probably damaging	Het
Mrpl58	A	T	11: 115,410,247	N128Y	probably damaging	Het
Ndufs2	T	C	1: 171,241,099	T54A	probably benign	Het
Notch2	G	T	3: 98,100,389		probably null	Het
Ntng1	A	T	3: 109,782,853	N424K	possibly damaging	Het
Ntrk2	G	A	13: 58,861,299	W301*	probably null	Het
Olfr1471	T	A	19: 13,445,767	S252T	probably benign	Het
Otud6b	A	G	4: 14,822,766	S113P	possibly damaging	Het
Papd7	A	C	13: 69,510,666	M350R	possibly damaging	Het
Pcdhb20	A	G	18: 37,505,555	N378S	probably damaging	Het
Polr3b	T	C	10: 84,638,111	S185P	possibly damaging	Het
Ptprn	G	A	1: 75,264,037	R31C	probably benign	Het
Rgsl1	C	T	1: 153,822,371	V478M	probably damaging	Het
Sema6b	A	T	17: 56,132,784	L19*	probably null	Het
Slfn8	A	G	11: 83,004,055		probably null	Het
Spen	A	T	4: 141,476,310	S1669T	unknown	Het
Syne2	T	C	12: 76,096,966	F1522L	probably damaging	Het
Tarbp1	C	T	8: 126,459,044	A470T	possibly damaging	Het
Tiam1	C	A	16: 89,898,024	E182*	probably null	Het
Tmem231	G	A	8: 111,926,892		probably benign	Het
Trip12	C	T	1: 84,793,870	A186T	probably damaging	Het
Ufc1	C	T	1: 171,288,956	A147T	probably damaging	Het
Vmn1r199	A	G	13: 22,383,607	K314R	possibly damaging	Het
Vmn2r13	A	T	5: 109,175,219	I68K	possibly damaging	Het
Vmn2r77	A	T	7: 86,811,559	I698F	probably damaging	Het
Vmn2r86	T	C	10: 130,446,926	K607R	probably damaging	Het
Vwa3b	T	C	1: 37,157,376	V28A	probably benign	Het
Wdr19	A	G	5: 65,215,893	N166S	possibly damaging	Het
Wfdc17	G	A	11: 83,704,808	G33R	probably damaging	Het
Zfp330	T	G	8: 82,764,916	K209N	probably benign	Het
Zfp493	A	G	13: 67,786,407	T160A	probably benign	Het
Zfp974	A	T	7: 27,911,515	C262S	possibly damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAACTACATGAATGGCGAGAAACTC -3'
(R):5'- AGGGTAAGAAGCTGCGTCTTC -3'

Sequencing Primer
(F):5'- CGAGCCATTGTTCATGAAAGC -3'
(R):5'- GTAAGAAGCTGCGTCTTCCTGAC -3'

Posted On

2018-05-24