Mutagenetix > Incidental Mutation

Incidental Mutation 'R6419:Slfn8'

518019

Institutional Source

Beutler Lab

Gene Symbol

Slfn8

Ensembl Gene

ENSMUSG00000035208

Gene Name

schlafen 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R6419 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83002158-83020810 bp(-) (GRCm38)

Type of Mutation

splice site (2 bp from exon)

DNA Base Change (assembly)

A to G at 83004055 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]

AlphaFold

B1ARD8

Predicted Effect

probably null
Transcript: ENSMUST00000038141

SMART Domains

Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	1.6e-18	PFAM
Pfam:DUF2075	592	766	5.8e-11	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000092838

SMART Domains

Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	205	341	1.4e-17	PFAM
Pfam:DUF2075	592	767	2.2e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108152

SMART Domains

Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	4.1e-19	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000130822

SMART Domains

Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	3.7e-19	PFAM
SCOP:d1ly1a_	593	625	4e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000131883

SMART Domains

Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	27	163	1.8e-15	PFAM
SCOP:d1ly1a_	370	402	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000215239

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.3%

Validation Efficiency

96% (67/70)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578G10Rik	T	C	4: 42,812,473		probably benign	Het
Abcc2	T	A	19: 43,837,508		probably null	Het
Adamts12	C	T	15: 11,215,673	T260M	possibly damaging	Het
Adamts20	C	T	15: 94,333,675	V878I	possibly damaging	Het
Adgrl4	A	G	3: 151,439,316	E34G	probably damaging	Het
Asah1	A	T	8: 41,343,766	I293N	probably damaging	Het
B3galt2	A	T	1: 143,647,101	E325V	possibly damaging	Het
Baz1b	T	A	5: 135,242,494	H1310Q	probably benign	Het
Ccdc125	T	A	13: 100,690,326	N204K	probably damaging	Het
Cd36	C	T	5: 17,797,152	D284N	probably benign	Het
Cdh12	T	C	15: 21,520,397	L316S	probably damaging	Het
Cenpv	T	C	11: 62,525,182	K247R	probably benign	Het
Cldn18	T	C	9: 99,692,748	H257R	possibly damaging	Het
Cnot8	T	A	11: 58,114,065	Y197N	probably damaging	Het
Cog3	A	T	14: 75,724,738	C554*	probably null	Het
Col4a4	A	G	1: 82,466,486		probably null	Het
Cops5	G	A	1: 10,033,307	T158I	probably damaging	Het
Dhh	A	G	15: 98,894,401	F242S	probably damaging	Het
Dot1l	T	C	10: 80,791,481	V1512A	possibly damaging	Het
Dstn	T	G	2: 143,939,987	I116S	possibly damaging	Het
Egfem1	G	A	3: 29,657,249	D326N	probably damaging	Het
Enpp3	A	T	10: 24,808,191	Y52N	probably damaging	Het
Fam214a	G	A	9: 75,009,337	S413N	probably benign	Het
Gabra2	A	G	5: 70,962,083	S359P	probably benign	Het
Gbp7	G	A	3: 142,546,453	G599E	probably benign	Het
Gcat	T	G	15: 79,036,064	I198S	probably damaging	Het
Gm8439	A	G	4: 120,609,558	K82R	unknown	Het
Grin2b	A	G	6: 135,740,967	F709S	probably damaging	Het
Grm3	T	C	5: 9,570,201	N348D	probably damaging	Het
Hdgfl1	G	A	13: 26,770,092		probably benign	Het
Hmgxb3	G	T	18: 61,152,224	D564E	possibly damaging	Het
Igkv4-61	C	A	6: 69,417,154	A31S	possibly damaging	Het
Impg1	A	G	9: 80,380,018	V305A	probably benign	Het
Ints7	T	A	1: 191,602,302	S313T	possibly damaging	Het
Knl1	T	A	2: 119,069,003	I395K	probably benign	Het
Lactb2	A	T	1: 13,638,235	Y196*	probably null	Het
Lad1	T	C	1: 135,831,892	S509P	possibly damaging	Het
Ltf	T	C	9: 111,031,022	F504L	possibly damaging	Het
Med4	A	T	14: 73,513,923	D104V	probably damaging	Het
Mrpl58	A	T	11: 115,410,247	N128Y	probably damaging	Het
Ndufs2	T	C	1: 171,241,099	T54A	probably benign	Het
Notch2	G	T	3: 98,100,389		probably null	Het
Ntng1	A	T	3: 109,782,853	N424K	possibly damaging	Het
Ntrk2	G	A	13: 58,861,299	W301*	probably null	Het
Olfr1471	T	A	19: 13,445,767	S252T	probably benign	Het
Otud6b	A	G	4: 14,822,766	S113P	possibly damaging	Het
Papd7	A	C	13: 69,510,666	M350R	possibly damaging	Het
Pcdhb20	A	G	18: 37,505,555	N378S	probably damaging	Het
Polr3b	T	C	10: 84,638,111	S185P	possibly damaging	Het
Ptprn	G	A	1: 75,264,037	R31C	probably benign	Het
Rgsl1	C	T	1: 153,822,371	V478M	probably damaging	Het
Sema6b	A	T	17: 56,132,784	L19*	probably null	Het
Spen	A	T	4: 141,476,310	S1669T	unknown	Het
Syne2	T	C	12: 76,096,966	F1522L	probably damaging	Het
Tarbp1	C	T	8: 126,459,044	A470T	possibly damaging	Het
Tiam1	C	A	16: 89,898,024	E182*	probably null	Het
Tmem231	G	A	8: 111,926,892		probably benign	Het
Trip12	C	T	1: 84,793,870	A186T	probably damaging	Het
Ufc1	C	T	1: 171,288,956	A147T	probably damaging	Het
Vmn1r199	A	G	13: 22,383,607	K314R	possibly damaging	Het
Vmn2r13	A	T	5: 109,175,219	I68K	possibly damaging	Het
Vmn2r77	A	T	7: 86,811,559	I698F	probably damaging	Het
Vmn2r86	T	C	10: 130,446,926	K607R	probably damaging	Het
Vwa3b	T	C	1: 37,157,376	V28A	probably benign	Het
Wdr19	A	G	5: 65,215,893	N166S	possibly damaging	Het
Wfdc17	G	A	11: 83,704,808	G33R	probably damaging	Het
Zfp330	T	G	8: 82,764,916	K209N	probably benign	Het
Zfp493	A	G	13: 67,786,407	T160A	probably benign	Het
Zfp974	A	T	7: 27,911,515	C262S	possibly damaging	Het

Other mutations in Slfn8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Slfn8	APN	11	83013484	missense	possibly damaging	0.75
IGL01418:Slfn8	APN	11	83004636	missense	probably damaging	1.00
IGL01620:Slfn8	APN	11	83004233	nonsense	probably null
IGL01875:Slfn8	APN	11	83004079	missense	probably benign	0.30
IGL01896:Slfn8	APN	11	83003696	missense	probably damaging	1.00
IGL01929:Slfn8	APN	11	83003405	nonsense	probably null
IGL02111:Slfn8	APN	11	83004498	missense	probably damaging	1.00
IGL02136:Slfn8	APN	11	83003465	nonsense	probably null
IGL02165:Slfn8	APN	11	83017196	missense	probably benign	0.00
IGL02645:Slfn8	APN	11	83003554	missense	possibly damaging	0.82
IGL02682:Slfn8	APN	11	83003691	missense	probably damaging	1.00
IGL02689:Slfn8	APN	11	83017108	missense	probably damaging	1.00
IGL02948:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03037:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03185:Slfn8	APN	11	83017507	missense	probably benign	0.01
IGL03243:Slfn8	APN	11	83003707	missense	probably damaging	1.00
IGL03286:Slfn8	APN	11	83013468	missense	probably damaging	0.99
seven_dwarfs	UTSW	11	83003334	missense	probably benign	0.09
vanwinkle	UTSW	11	83017393	missense	probably damaging	1.00
R0295:Slfn8	UTSW	11	83003343	nonsense	probably null
R0368:Slfn8	UTSW	11	83017132	missense	probably damaging	1.00
R0382:Slfn8	UTSW	11	83004556	missense	probably damaging	1.00
R0655:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R0894:Slfn8	UTSW	11	83003581	missense	probably benign	0.07
R1006:Slfn8	UTSW	11	83003511	missense	possibly damaging	0.69
R1181:Slfn8	UTSW	11	83016745	missense	probably benign	0.19
R1187:Slfn8	UTSW	11	83003488	missense	probably damaging	1.00
R1501:Slfn8	UTSW	11	83003180	missense	probably damaging	0.99
R1646:Slfn8	UTSW	11	83016886	missense	probably damaging	1.00
R1909:Slfn8	UTSW	11	83003621	nonsense	probably null
R2005:Slfn8	UTSW	11	83004150	missense	probably damaging	1.00
R2363:Slfn8	UTSW	11	83004094	missense	probably damaging	1.00
R3780:Slfn8	UTSW	11	83017454	missense	probably benign	0.13
R3890:Slfn8	UTSW	11	83004444	missense	possibly damaging	0.68
R3917:Slfn8	UTSW	11	83016993	nonsense	probably null
R4559:Slfn8	UTSW	11	83004744	missense	probably damaging	1.00
R4684:Slfn8	UTSW	11	83017506	missense	probably benign	0.10
R4767:Slfn8	UTSW	11	83003197	missense	possibly damaging	0.66
R4773:Slfn8	UTSW	11	83017393	missense	probably damaging	1.00
R4859:Slfn8	UTSW	11	83017714	start codon destroyed	probably null	0.99
R4916:Slfn8	UTSW	11	83016878	missense	probably damaging	1.00
R4939:Slfn8	UTSW	11	83003285	missense	probably benign	0.01
R5107:Slfn8	UTSW	11	83017150	missense	probably damaging	0.99
R5130:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R5165:Slfn8	UTSW	11	83017127	missense	probably damaging	0.99
R5238:Slfn8	UTSW	11	83013388	missense	probably damaging	0.96
R5282:Slfn8	UTSW	11	83017724	critical splice acceptor site	probably null
R5311:Slfn8	UTSW	11	83004084	missense	probably damaging	1.00
R5499:Slfn8	UTSW	11	83004216	missense	probably damaging	0.99
R5617:Slfn8	UTSW	11	83004721	missense	probably benign	0.01
R5782:Slfn8	UTSW	11	83017041	missense	probably damaging	0.98
R5823:Slfn8	UTSW	11	83016736	missense	probably benign	0.01
R5886:Slfn8	UTSW	11	83003334	missense	probably benign	0.09
R5933:Slfn8	UTSW	11	83003335	missense	probably benign	0.00
R6151:Slfn8	UTSW	11	83017321	missense	probably damaging	1.00
R6163:Slfn8	UTSW	11	83003864	makesense	probably null
R6191:Slfn8	UTSW	11	83016800	missense	possibly damaging	0.72
R6925:Slfn8	UTSW	11	83013417	nonsense	probably null
R7065:Slfn8	UTSW	11	83016968	missense	probably benign	0.01
R7380:Slfn8	UTSW	11	83003740	missense	not run
R7414:Slfn8	UTSW	11	83016792	nonsense	probably null
R7819:Slfn8	UTSW	11	83004255	missense	probably damaging	1.00
R8425:Slfn8	UTSW	11	83004615	missense	possibly damaging	0.80
R8517:Slfn8	UTSW	11	83004142	missense	possibly damaging	0.68
R8804:Slfn8	UTSW	11	83016813	missense	possibly damaging	0.94
R8814:Slfn8	UTSW	11	83016679	missense	possibly damaging	0.95
R9069:Slfn8	UTSW	11	83017076	missense	probably damaging	1.00
R9233:Slfn8	UTSW	11	83003596	missense	probably damaging	1.00
R9457:Slfn8	UTSW	11	83017706	missense	probably benign
R9678:Slfn8	UTSW	11	83016897	missense	probably damaging	1.00
R9708:Slfn8	UTSW	11	83003441	missense	probably benign	0.00
R9764:Slfn8	UTSW	11	83017012	missense	probably damaging	1.00
X0021:Slfn8	UTSW	11	83016928	missense	possibly damaging	0.69
Z1177:Slfn8	UTSW	11	83003533	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- TCATGAAGGTTTTCCGGGTC -3'
(R):5'- AGCCCAACAGTATGAGATTCTCTC -3'

Sequencing Primer
(F):5'- AAGGTTTTCCGGGTCACTGC -3'
(R):5'- GAGATTCTCTCAAAAAGTCTCCGC -3'

Posted On

2018-05-24