Incidental Mutation 'R6419:Adamts12'
ID 518031
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms
MMRRC Submission 044561-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R6419 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 11064876-11349317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11215759 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 260 (T260M)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect possibly damaging
Transcript: ENSMUST00000061318
AA Change: T260M

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: T260M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228940
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T C 4: 42,812,473 (GRCm39) probably benign Het
Abcc2 T A 19: 43,825,947 (GRCm39) probably null Het
Adamts20 C T 15: 94,231,556 (GRCm39) V878I possibly damaging Het
Adgrl4 A G 3: 151,144,953 (GRCm39) E34G probably damaging Het
Asah1 A T 8: 41,796,803 (GRCm39) I293N probably damaging Het
Atosa G A 9: 74,916,619 (GRCm39) S413N probably benign Het
B3galt2 A T 1: 143,522,839 (GRCm39) E325V possibly damaging Het
Baz1b T A 5: 135,271,348 (GRCm39) H1310Q probably benign Het
Ccdc125 T A 13: 100,826,834 (GRCm39) N204K probably damaging Het
Cd36 C T 5: 18,002,150 (GRCm39) D284N probably benign Het
Cdh12 T C 15: 21,520,483 (GRCm39) L316S probably damaging Het
Cenpv T C 11: 62,416,008 (GRCm39) K247R probably benign Het
Cldn18 T C 9: 99,574,801 (GRCm39) H257R possibly damaging Het
Cnot8 T A 11: 58,004,891 (GRCm39) Y197N probably damaging Het
Cog3 A T 14: 75,962,178 (GRCm39) C554* probably null Het
Col4a4 A G 1: 82,444,207 (GRCm39) probably null Het
Cops5 G A 1: 10,103,532 (GRCm39) T158I probably damaging Het
Dhh A G 15: 98,792,282 (GRCm39) F242S probably damaging Het
Dot1l T C 10: 80,627,315 (GRCm39) V1512A possibly damaging Het
Dstn T G 2: 143,781,907 (GRCm39) I116S possibly damaging Het
Egfem1 G A 3: 29,711,398 (GRCm39) D326N probably damaging Het
Enpp3 A T 10: 24,684,089 (GRCm39) Y52N probably damaging Het
Gabra2 A G 5: 71,119,426 (GRCm39) S359P probably benign Het
Gbp7 G A 3: 142,252,214 (GRCm39) G599E probably benign Het
Gcat T G 15: 78,920,264 (GRCm39) I198S probably damaging Het
Gm8439 A G 4: 120,466,755 (GRCm39) K82R unknown Het
Grin2b A G 6: 135,717,965 (GRCm39) F709S probably damaging Het
Grm3 T C 5: 9,620,201 (GRCm39) N348D probably damaging Het
Hdgfl1 G A 13: 26,954,075 (GRCm39) probably benign Het
Hmgxb3 G T 18: 61,285,296 (GRCm39) D564E possibly damaging Het
Igkv4-61 C A 6: 69,394,138 (GRCm39) A31S possibly damaging Het
Impg1 A G 9: 80,287,300 (GRCm39) V305A probably benign Het
Ints7 T A 1: 191,334,414 (GRCm39) S313T possibly damaging Het
Knl1 T A 2: 118,899,484 (GRCm39) I395K probably benign Het
Lactb2 A T 1: 13,708,459 (GRCm39) Y196* probably null Het
Lad1 T C 1: 135,759,630 (GRCm39) S509P possibly damaging Het
Ltf T C 9: 110,860,090 (GRCm39) F504L possibly damaging Het
Med4 A T 14: 73,751,363 (GRCm39) D104V probably damaging Het
Mrpl58 A T 11: 115,301,073 (GRCm39) N128Y probably damaging Het
Ndufs2 T C 1: 171,068,668 (GRCm39) T54A probably benign Het
Notch2 G T 3: 98,007,705 (GRCm39) probably null Het
Ntng1 A T 3: 109,690,169 (GRCm39) N424K possibly damaging Het
Ntrk2 G A 13: 59,009,113 (GRCm39) W301* probably null Het
Or5b116 T A 19: 13,423,131 (GRCm39) S252T probably benign Het
Otud6b A G 4: 14,822,766 (GRCm39) S113P possibly damaging Het
Pcdhb20 A G 18: 37,638,608 (GRCm39) N378S probably damaging Het
Polr3b T C 10: 84,473,975 (GRCm39) S185P possibly damaging Het
Ptprn G A 1: 75,240,681 (GRCm39) R31C probably benign Het
Rgsl1 C T 1: 153,698,117 (GRCm39) V478M probably damaging Het
Sema6b A T 17: 56,439,784 (GRCm39) L19* probably null Het
Slfn8 A G 11: 82,894,881 (GRCm39) probably null Het
Spen A T 4: 141,203,621 (GRCm39) S1669T unknown Het
Syne2 T C 12: 76,143,740 (GRCm39) F1522L probably damaging Het
Tarbp1 C T 8: 127,185,783 (GRCm39) A470T possibly damaging Het
Tent4a A C 13: 69,658,785 (GRCm39) M350R possibly damaging Het
Tiam1 C A 16: 89,694,912 (GRCm39) E182* probably null Het
Tmem231 G A 8: 112,653,524 (GRCm39) probably benign Het
Trip12 C T 1: 84,771,591 (GRCm39) A186T probably damaging Het
Ufc1 C T 1: 171,116,529 (GRCm39) A147T probably damaging Het
Vmn1r199 A G 13: 22,567,777 (GRCm39) K314R possibly damaging Het
Vmn2r13 A T 5: 109,323,085 (GRCm39) I68K possibly damaging Het
Vmn2r77 A T 7: 86,460,767 (GRCm39) I698F probably damaging Het
Vmn2r86 T C 10: 130,282,795 (GRCm39) K607R probably damaging Het
Vwa3b T C 1: 37,196,457 (GRCm39) V28A probably benign Het
Wdr19 A G 5: 65,373,236 (GRCm39) N166S possibly damaging Het
Wfdc17 G A 11: 83,595,634 (GRCm39) G33R probably damaging Het
Zfp330 T G 8: 83,491,545 (GRCm39) K209N probably benign Het
Zfp493 A G 13: 67,934,526 (GRCm39) T160A probably benign Het
Zfp974 A T 7: 27,610,940 (GRCm39) C262S possibly damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11,311,685 (GRCm39) missense probably benign 0.00
IGL00513:Adamts12 APN 15 11,257,047 (GRCm39) missense probably benign 0.28
IGL00579:Adamts12 APN 15 11,152,100 (GRCm39) missense probably benign 0.20
IGL00984:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL01307:Adamts12 APN 15 11,237,632 (GRCm39) missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11,071,939 (GRCm39) missense probably benign 0.30
IGL01353:Adamts12 APN 15 11,292,091 (GRCm39) splice site probably benign
IGL01373:Adamts12 APN 15 11,310,816 (GRCm39) missense probably benign 0.00
IGL01522:Adamts12 APN 15 11,065,245 (GRCm39) critical splice donor site probably null
IGL01589:Adamts12 APN 15 11,311,323 (GRCm39) missense probably benign 0.26
IGL01715:Adamts12 APN 15 11,258,182 (GRCm39) missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11,258,269 (GRCm39) missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11,345,680 (GRCm39) missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL02216:Adamts12 APN 15 11,241,571 (GRCm39) missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11,311,101 (GRCm39) missense probably benign 0.01
IGL02336:Adamts12 APN 15 11,311,331 (GRCm39) missense probably benign 0.02
IGL02445:Adamts12 APN 15 11,286,798 (GRCm39) missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11,263,422 (GRCm39) missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11,345,650 (GRCm39) missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11,292,168 (GRCm39) missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11,241,574 (GRCm39) missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11,286,896 (GRCm39) missense probably benign 0.33
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0122:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11,071,594 (GRCm39) missense probably benign 0.11
R0308:Adamts12 UTSW 15 11,311,646 (GRCm39) missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11,311,144 (GRCm39) missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11,255,769 (GRCm39) missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11,277,544 (GRCm39) critical splice donor site probably null
R1173:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1174:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1319:Adamts12 UTSW 15 11,286,877 (GRCm39) missense probably benign 0.02
R1344:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11,256,980 (GRCm39) splice site probably benign
R1396:Adamts12 UTSW 15 11,311,558 (GRCm39) missense probably benign 0.01
R1418:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11,263,447 (GRCm39) missense probably benign 0.42
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1599:Adamts12 UTSW 15 11,071,797 (GRCm39) missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11,152,143 (GRCm39) missense probably benign 0.00
R1748:Adamts12 UTSW 15 11,241,548 (GRCm39) missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11,071,606 (GRCm39) missense probably benign 0.06
R1870:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1871:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1872:Adamts12 UTSW 15 11,217,966 (GRCm39) nonsense probably null
R1931:Adamts12 UTSW 15 11,270,685 (GRCm39) missense probably benign 0.00
R2041:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11,065,174 (GRCm39) missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11,286,169 (GRCm39) missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11,071,840 (GRCm39) missense probably benign
R4666:Adamts12 UTSW 15 11,311,578 (GRCm39) missense probably benign 0.08
R4731:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11,285,987 (GRCm39) missense probably benign 0.03
R4877:Adamts12 UTSW 15 11,327,787 (GRCm39) missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11,259,108 (GRCm39) missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11,300,054 (GRCm39) missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11,285,962 (GRCm39) missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11,327,843 (GRCm39) missense probably benign 0.18
R5492:Adamts12 UTSW 15 11,336,384 (GRCm39) missense probably benign 0.05
R5580:Adamts12 UTSW 15 11,152,086 (GRCm39) missense probably benign 0.14
R5645:Adamts12 UTSW 15 11,277,506 (GRCm39) missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11,286,836 (GRCm39) missense probably benign 0.15
R6240:Adamts12 UTSW 15 11,286,044 (GRCm39) missense probably benign 0.44
R6331:Adamts12 UTSW 15 11,241,519 (GRCm39) missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11,257,080 (GRCm39) missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11,255,721 (GRCm39) missense probably damaging 0.97
R6571:Adamts12 UTSW 15 11,065,187 (GRCm39) missense probably benign 0.00
R6821:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.14
R6913:Adamts12 UTSW 15 11,215,778 (GRCm39) missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11,331,866 (GRCm39) nonsense probably null
R7188:Adamts12 UTSW 15 11,336,411 (GRCm39) nonsense probably null
R7290:Adamts12 UTSW 15 11,277,452 (GRCm39) missense probably benign 0.08
R7307:Adamts12 UTSW 15 11,217,899 (GRCm39) missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11,277,425 (GRCm39) missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11,317,365 (GRCm39) missense probably benign 0.00
R7484:Adamts12 UTSW 15 11,345,734 (GRCm39) missense probably benign 0.25
R7562:Adamts12 UTSW 15 11,270,697 (GRCm39) missense probably benign 0.01
R7653:Adamts12 UTSW 15 11,257,115 (GRCm39) missense probably benign 0.28
R7696:Adamts12 UTSW 15 11,258,224 (GRCm39) missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11,317,298 (GRCm39) missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11,263,423 (GRCm39) missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11,310,904 (GRCm39) missense probably benign
R8032:Adamts12 UTSW 15 11,259,189 (GRCm39) critical splice donor site probably null
R8109:Adamts12 UTSW 15 11,331,877 (GRCm39) missense probably benign 0.02
R8402:Adamts12 UTSW 15 11,263,376 (GRCm39) missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11,215,813 (GRCm39) missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11,237,678 (GRCm39) missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11,300,015 (GRCm39) missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11,286,065 (GRCm39) missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11,317,443 (GRCm39) critical splice donor site probably null
R9042:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.08
R9162:Adamts12 UTSW 15 11,311,721 (GRCm39) missense probably benign 0.29
R9190:Adamts12 UTSW 15 11,336,446 (GRCm39) missense probably benign 0.02
R9700:Adamts12 UTSW 15 11,311,442 (GRCm39) missense probably benign 0.04
R9748:Adamts12 UTSW 15 11,310,628 (GRCm39) missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
X0022:Adamts12 UTSW 15 11,277,534 (GRCm39) missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,317,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTTCACCCAGACACATGAG -3'
(R):5'- CCAGATTTGGGGATCATGTTGC -3'

Sequencing Primer
(F):5'- GTTTCACCCAGACACATGAGAACATC -3'
(R):5'- CCTGGCAAGAATACTTTTTGATGAGG -3'
Posted On 2018-05-24