Incidental Mutation 'R6419:Adamts12'
ID518031
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
SynonymsAI605170; ADAMTS-12
MMRRC Submission
Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6419 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location11064790-11349231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11215673 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 260 (T260M)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061318
AA Change: T260M

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: T260M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228940
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T C 4: 42,812,473 probably benign Het
Abcc2 T A 19: 43,837,508 probably null Het
Adamts20 C T 15: 94,333,675 V878I possibly damaging Het
Adgrl4 A G 3: 151,439,316 E34G probably damaging Het
Asah1 A T 8: 41,343,766 I293N probably damaging Het
B3galt2 A T 1: 143,647,101 E325V possibly damaging Het
Baz1b T A 5: 135,242,494 H1310Q probably benign Het
Ccdc125 T A 13: 100,690,326 N204K probably damaging Het
Cd36 C T 5: 17,797,152 D284N probably benign Het
Cdh12 T C 15: 21,520,397 L316S probably damaging Het
Cenpv T C 11: 62,525,182 K247R probably benign Het
Cldn18 T C 9: 99,692,748 H257R possibly damaging Het
Cnot8 T A 11: 58,114,065 Y197N probably damaging Het
Cog3 A T 14: 75,724,738 C554* probably null Het
Col4a4 A G 1: 82,466,486 probably null Het
Cops5 G A 1: 10,033,307 T158I probably damaging Het
Dhh A G 15: 98,894,401 F242S probably damaging Het
Dot1l T C 10: 80,791,481 V1512A possibly damaging Het
Dstn T G 2: 143,939,987 I116S possibly damaging Het
Egfem1 G A 3: 29,657,249 D326N probably damaging Het
Enpp3 A T 10: 24,808,191 Y52N probably damaging Het
Fam214a G A 9: 75,009,337 S413N probably benign Het
Gabra2 A G 5: 70,962,083 S359P probably benign Het
Gbp7 G A 3: 142,546,453 G599E probably benign Het
Gcat T G 15: 79,036,064 I198S probably damaging Het
Gm8439 A G 4: 120,609,558 K82R unknown Het
Grin2b A G 6: 135,740,967 F709S probably damaging Het
Grm3 T C 5: 9,570,201 N348D probably damaging Het
Hdgfl1 G A 13: 26,770,092 probably benign Het
Hmgxb3 G T 18: 61,152,224 D564E possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Impg1 A G 9: 80,380,018 V305A probably benign Het
Ints7 T A 1: 191,602,302 S313T possibly damaging Het
Knl1 T A 2: 119,069,003 I395K probably benign Het
Lactb2 A T 1: 13,638,235 Y196* probably null Het
Lad1 T C 1: 135,831,892 S509P possibly damaging Het
Ltf T C 9: 111,031,022 F504L possibly damaging Het
Med4 A T 14: 73,513,923 D104V probably damaging Het
Mrpl58 A T 11: 115,410,247 N128Y probably damaging Het
Ndufs2 T C 1: 171,241,099 T54A probably benign Het
Notch2 G T 3: 98,100,389 probably null Het
Ntng1 A T 3: 109,782,853 N424K possibly damaging Het
Ntrk2 G A 13: 58,861,299 W301* probably null Het
Olfr1471 T A 19: 13,445,767 S252T probably benign Het
Otud6b A G 4: 14,822,766 S113P possibly damaging Het
Papd7 A C 13: 69,510,666 M350R possibly damaging Het
Pcdhb20 A G 18: 37,505,555 N378S probably damaging Het
Polr3b T C 10: 84,638,111 S185P possibly damaging Het
Ptprn G A 1: 75,264,037 R31C probably benign Het
Rgsl1 C T 1: 153,822,371 V478M probably damaging Het
Sema6b A T 17: 56,132,784 L19* probably null Het
Slfn8 A G 11: 83,004,055 probably null Het
Spen A T 4: 141,476,310 S1669T unknown Het
Syne2 T C 12: 76,096,966 F1522L probably damaging Het
Tarbp1 C T 8: 126,459,044 A470T possibly damaging Het
Tiam1 C A 16: 89,898,024 E182* probably null Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trip12 C T 1: 84,793,870 A186T probably damaging Het
Ufc1 C T 1: 171,288,956 A147T probably damaging Het
Vmn1r199 A G 13: 22,383,607 K314R possibly damaging Het
Vmn2r13 A T 5: 109,175,219 I68K possibly damaging Het
Vmn2r77 A T 7: 86,811,559 I698F probably damaging Het
Vmn2r86 T C 10: 130,446,926 K607R probably damaging Het
Vwa3b T C 1: 37,157,376 V28A probably benign Het
Wdr19 A G 5: 65,215,893 N166S possibly damaging Het
Wfdc17 G A 11: 83,704,808 G33R probably damaging Het
Zfp330 T G 8: 82,764,916 K209N probably benign Het
Zfp493 A G 13: 67,786,407 T160A probably benign Het
Zfp974 A T 7: 27,911,515 C262S possibly damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11286810 missense probably benign 0.33
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11311058 missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1599:Adamts12 UTSW 15 11071711 missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1748:Adamts12 UTSW 15 11241462 missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6240:Adamts12 UTSW 15 11285958 missense probably benign 0.44
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11255635 missense probably damaging 0.97
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
R7188:Adamts12 UTSW 15 11336325 nonsense probably null
R7290:Adamts12 UTSW 15 11277366 missense probably benign 0.08
R7307:Adamts12 UTSW 15 11217813 missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11277339 missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11317279 missense probably benign 0.00
R7484:Adamts12 UTSW 15 11345648 missense probably benign 0.25
R7562:Adamts12 UTSW 15 11270611 missense probably benign 0.01
R7653:Adamts12 UTSW 15 11257029 missense probably benign 0.28
R7696:Adamts12 UTSW 15 11258138 missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11317212 missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11263337 missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11310818 missense probably benign
R8032:Adamts12 UTSW 15 11259103 critical splice donor site probably null
R8109:Adamts12 UTSW 15 11331791 missense probably benign 0.02
R8402:Adamts12 UTSW 15 11263290 missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11215727 missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11237592 missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11299929 missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11285979 missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11317357 critical splice donor site probably null
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11336383 missense not run
Z1177:Adamts12 UTSW 15 11317324 missense probably damaging 1.00
Z1177:Adamts12 UTSW 15 11336383 missense not run
Predicted Primers PCR Primer
(F):5'- CTGTTTCACCCAGACACATGAG -3'
(R):5'- CCAGATTTGGGGATCATGTTGC -3'

Sequencing Primer
(F):5'- GTTTCACCCAGACACATGAGAACATC -3'
(R):5'- CCTGGCAAGAATACTTTTTGATGAGG -3'
Posted On2018-05-24