Mutagenetix > Incidental Mutation

Incidental Mutation 'R6419:Adamts12'

518031

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R6419 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 11215673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 260 (T260M)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

AlphaFold

Q811B3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061318
AA Change: T260M

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: T260M

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228940

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.3%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578G10Rik	T	C	4: 42,812,473		probably benign	Het
Abcc2	T	A	19: 43,837,508		probably null	Het
Adamts20	C	T	15: 94,333,675	V878I	possibly damaging	Het
Adgrl4	A	G	3: 151,439,316	E34G	probably damaging	Het
Asah1	A	T	8: 41,343,766	I293N	probably damaging	Het
B3galt2	A	T	1: 143,647,101	E325V	possibly damaging	Het
Baz1b	T	A	5: 135,242,494	H1310Q	probably benign	Het
Ccdc125	T	A	13: 100,690,326	N204K	probably damaging	Het
Cd36	C	T	5: 17,797,152	D284N	probably benign	Het
Cdh12	T	C	15: 21,520,397	L316S	probably damaging	Het
Cenpv	T	C	11: 62,525,182	K247R	probably benign	Het
Cldn18	T	C	9: 99,692,748	H257R	possibly damaging	Het
Cnot8	T	A	11: 58,114,065	Y197N	probably damaging	Het
Cog3	A	T	14: 75,724,738	C554*	probably null	Het
Col4a4	A	G	1: 82,466,486		probably null	Het
Cops5	G	A	1: 10,033,307	T158I	probably damaging	Het
Dhh	A	G	15: 98,894,401	F242S	probably damaging	Het
Dot1l	T	C	10: 80,791,481	V1512A	possibly damaging	Het
Dstn	T	G	2: 143,939,987	I116S	possibly damaging	Het
Egfem1	G	A	3: 29,657,249	D326N	probably damaging	Het
Enpp3	A	T	10: 24,808,191	Y52N	probably damaging	Het
Fam214a	G	A	9: 75,009,337	S413N	probably benign	Het
Gabra2	A	G	5: 70,962,083	S359P	probably benign	Het
Gbp7	G	A	3: 142,546,453	G599E	probably benign	Het
Gcat	T	G	15: 79,036,064	I198S	probably damaging	Het
Gm8439	A	G	4: 120,609,558	K82R	unknown	Het
Grin2b	A	G	6: 135,740,967	F709S	probably damaging	Het
Grm3	T	C	5: 9,570,201	N348D	probably damaging	Het
Hdgfl1	G	A	13: 26,770,092		probably benign	Het
Hmgxb3	G	T	18: 61,152,224	D564E	possibly damaging	Het
Igkv4-61	C	A	6: 69,417,154	A31S	possibly damaging	Het
Impg1	A	G	9: 80,380,018	V305A	probably benign	Het
Ints7	T	A	1: 191,602,302	S313T	possibly damaging	Het
Knl1	T	A	2: 119,069,003	I395K	probably benign	Het
Lactb2	A	T	1: 13,638,235	Y196*	probably null	Het
Lad1	T	C	1: 135,831,892	S509P	possibly damaging	Het
Ltf	T	C	9: 111,031,022	F504L	possibly damaging	Het
Med4	A	T	14: 73,513,923	D104V	probably damaging	Het
Mrpl58	A	T	11: 115,410,247	N128Y	probably damaging	Het
Ndufs2	T	C	1: 171,241,099	T54A	probably benign	Het
Notch2	G	T	3: 98,100,389		probably null	Het
Ntng1	A	T	3: 109,782,853	N424K	possibly damaging	Het
Ntrk2	G	A	13: 58,861,299	W301*	probably null	Het
Olfr1471	T	A	19: 13,445,767	S252T	probably benign	Het
Otud6b	A	G	4: 14,822,766	S113P	possibly damaging	Het
Papd7	A	C	13: 69,510,666	M350R	possibly damaging	Het
Pcdhb20	A	G	18: 37,505,555	N378S	probably damaging	Het
Polr3b	T	C	10: 84,638,111	S185P	possibly damaging	Het
Ptprn	G	A	1: 75,264,037	R31C	probably benign	Het
Rgsl1	C	T	1: 153,822,371	V478M	probably damaging	Het
Sema6b	A	T	17: 56,132,784	L19*	probably null	Het
Slfn8	A	G	11: 83,004,055		probably null	Het
Spen	A	T	4: 141,476,310	S1669T	unknown	Het
Syne2	T	C	12: 76,096,966	F1522L	probably damaging	Het
Tarbp1	C	T	8: 126,459,044	A470T	possibly damaging	Het
Tiam1	C	A	16: 89,898,024	E182*	probably null	Het
Tmem231	G	A	8: 111,926,892		probably benign	Het
Trip12	C	T	1: 84,793,870	A186T	probably damaging	Het
Ufc1	C	T	1: 171,288,956	A147T	probably damaging	Het
Vmn1r199	A	G	13: 22,383,607	K314R	possibly damaging	Het
Vmn2r13	A	T	5: 109,175,219	I68K	possibly damaging	Het
Vmn2r77	A	T	7: 86,811,559	I698F	probably damaging	Het
Vmn2r86	T	C	10: 130,446,926	K607R	probably damaging	Het
Vwa3b	T	C	1: 37,157,376	V28A	probably benign	Het
Wdr19	A	G	5: 65,215,893	N166S	possibly damaging	Het
Wfdc17	G	A	11: 83,704,808	G33R	probably damaging	Het
Zfp330	T	G	8: 82,764,916	K209N	probably benign	Het
Zfp493	A	G	13: 67,786,407	T160A	probably benign	Het
Zfp974	A	T	7: 27,911,515	C262S	possibly damaging	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1447:Adamts12	UTSW	15	11263361	missense	probably benign	0.42
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4666:Adamts12	UTSW	15	11311492	missense	probably benign	0.08
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R4929:Adamts12	UTSW	15	11259022	missense	probably damaging	0.96
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5580:Adamts12	UTSW	15	11152000	missense	probably benign	0.14
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6393:Adamts12	UTSW	15	11255635	missense	probably damaging	0.97
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6913:Adamts12	UTSW	15	11215692	missense	probably damaging	1.00
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7188:Adamts12	UTSW	15	11336325	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7562:Adamts12	UTSW	15	11270611	missense	probably benign	0.01
R7653:Adamts12	UTSW	15	11257029	missense	probably benign	0.28
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7980:Adamts12	UTSW	15	11263337	missense	probably damaging	1.00
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
R9042:Adamts12	UTSW	15	11152048	missense	probably benign	0.08
R9162:Adamts12	UTSW	15	11311635	missense	probably benign	0.29
R9190:Adamts12	UTSW	15	11336360	missense	probably benign	0.02
R9700:Adamts12	UTSW	15	11311356	missense	probably benign	0.04
R9748:Adamts12	UTSW	15	11310542	missense	probably damaging	0.99
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- CTGTTTCACCCAGACACATGAG -3'
(R):5'- CCAGATTTGGGGATCATGTTGC -3'

Sequencing Primer
(F):5'- GTTTCACCCAGACACATGAGAACATC -3'
(R):5'- CCTGGCAAGAATACTTTTTGATGAGG -3'

Posted On

2018-05-24