Incidental Mutation 'R6419:Abcc2'
ID518041
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonymsmultidrug resistance protein 2, Cmoat, Mrp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6419 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location43782192-43840740 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 43837508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208] [ENSMUST00000099413]
Predicted Effect probably null
Transcript: ENSMUST00000026208
AA Change: L1528*
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: L1528*

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099413
Meta Mutation Damage Score 0.1082 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T C 4: 42,812,473 probably benign Het
Adamts12 C T 15: 11,215,673 T260M possibly damaging Het
Adamts20 C T 15: 94,333,675 V878I possibly damaging Het
Adgrl4 A G 3: 151,439,316 E34G probably damaging Het
Asah1 A T 8: 41,343,766 I293N probably damaging Het
B3galt2 A T 1: 143,647,101 E325V possibly damaging Het
Baz1b T A 5: 135,242,494 H1310Q probably benign Het
Ccdc125 T A 13: 100,690,326 N204K probably damaging Het
Cd36 C T 5: 17,797,152 D284N probably benign Het
Cdh12 T C 15: 21,520,397 L316S probably damaging Het
Cenpv T C 11: 62,525,182 K247R probably benign Het
Cldn18 T C 9: 99,692,748 H257R possibly damaging Het
Cnot8 T A 11: 58,114,065 Y197N probably damaging Het
Cog3 A T 14: 75,724,738 C554* probably null Het
Col4a4 A G 1: 82,466,486 probably null Het
Cops5 G A 1: 10,033,307 T158I probably damaging Het
Dhh A G 15: 98,894,401 F242S probably damaging Het
Dot1l T C 10: 80,791,481 V1512A possibly damaging Het
Dstn T G 2: 143,939,987 I116S possibly damaging Het
Egfem1 G A 3: 29,657,249 D326N probably damaging Het
Enpp3 A T 10: 24,808,191 Y52N probably damaging Het
Fam214a G A 9: 75,009,337 S413N probably benign Het
Gabra2 A G 5: 70,962,083 S359P probably benign Het
Gbp7 G A 3: 142,546,453 G599E probably benign Het
Gcat T G 15: 79,036,064 I198S probably damaging Het
Gm8439 A G 4: 120,609,558 K82R unknown Het
Grin2b A G 6: 135,740,967 F709S probably damaging Het
Grm3 T C 5: 9,570,201 N348D probably damaging Het
Hdgfl1 G A 13: 26,770,092 probably benign Het
Hmgxb3 G T 18: 61,152,224 D564E possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Impg1 A G 9: 80,380,018 V305A probably benign Het
Ints7 T A 1: 191,602,302 S313T possibly damaging Het
Knl1 T A 2: 119,069,003 I395K probably benign Het
Lactb2 A T 1: 13,638,235 Y196* probably null Het
Lad1 T C 1: 135,831,892 S509P possibly damaging Het
Ltf T C 9: 111,031,022 F504L possibly damaging Het
Med4 A T 14: 73,513,923 D104V probably damaging Het
Mrpl58 A T 11: 115,410,247 N128Y probably damaging Het
Ndufs2 T C 1: 171,241,099 T54A probably benign Het
Notch2 G T 3: 98,100,389 probably null Het
Ntng1 A T 3: 109,782,853 N424K possibly damaging Het
Ntrk2 G A 13: 58,861,299 W301* probably null Het
Olfr1471 T A 19: 13,445,767 S252T probably benign Het
Otud6b A G 4: 14,822,766 S113P possibly damaging Het
Papd7 A C 13: 69,510,666 M350R possibly damaging Het
Pcdhb20 A G 18: 37,505,555 N378S probably damaging Het
Polr3b T C 10: 84,638,111 S185P possibly damaging Het
Ptprn G A 1: 75,264,037 R31C probably benign Het
Rgsl1 C T 1: 153,822,371 V478M probably damaging Het
Sema6b A T 17: 56,132,784 L19* probably null Het
Slfn8 A G 11: 83,004,055 probably null Het
Spen A T 4: 141,476,310 S1669T unknown Het
Syne2 T C 12: 76,096,966 F1522L probably damaging Het
Tarbp1 C T 8: 126,459,044 A470T possibly damaging Het
Tiam1 C A 16: 89,898,024 E182* probably null Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trip12 C T 1: 84,793,870 A186T probably damaging Het
Ufc1 C T 1: 171,288,956 A147T probably damaging Het
Vmn1r199 A G 13: 22,383,607 K314R possibly damaging Het
Vmn2r13 A T 5: 109,175,219 I68K possibly damaging Het
Vmn2r77 A T 7: 86,811,559 I698F probably damaging Het
Vmn2r86 T C 10: 130,446,926 K607R probably damaging Het
Vwa3b T C 1: 37,157,376 V28A probably benign Het
Wdr19 A G 5: 65,215,893 N166S possibly damaging Het
Wfdc17 G A 11: 83,704,808 G33R probably damaging Het
Zfp330 T G 8: 82,764,916 K209N probably benign Het
Zfp493 A G 13: 67,786,407 T160A probably benign Het
Zfp974 A T 7: 27,911,515 C262S possibly damaging Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
BB002:Abcc2 UTSW 19 43807112 missense probably benign 0.07
BB012:Abcc2 UTSW 19 43807112 missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 utr 5 prime probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43826593 missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43784246 missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43830427 missense probably benign 0.01
R7911:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R7925:Abcc2 UTSW 19 43807112 missense probably benign 0.07
R8097:Abcc2 UTSW 19 43816955 missense probably benign 0.10
R8177:Abcc2 UTSW 19 43807080 missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43803734 missense probably benign 0.05
Z1177:Abcc2 UTSW 19 43803736 missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43823100 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTCACTGCTGAGGTTCATTC -3'
(R):5'- TGAGACCAGAGATTGCTTGAGC -3'

Sequencing Primer
(F):5'- GTTGGTGACTTACTGACTACAGC -3'
(R):5'- ACCAGAGATTGCTTGAGCCTTAG -3'
Posted On2018-05-24