Incidental Mutation 'R6418:Ush2a'
ID 518044
Institutional Source Beutler Lab
Gene Symbol Ush2a
Ensembl Gene ENSMUSG00000026609
Gene Name usherin
Synonyms MUSH2A, LOC269160, LOC381317, Ushrn, Ush2a, A930037M10Rik, A930011D15Rik
MMRRC Submission 044560-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.501) question?
Stock # R6418 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 187995035-188697694 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 188360763 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 2161 (N2161I)
Ref Sequence ENSEMBL: ENSMUSP00000050454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060479]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000060479
AA Change: N2161I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050454
Gene: ENSMUSG00000026609
AA Change: N2161I

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Laminin_G_3 128 283 6.5e-16 PFAM
LamNT 310 513 6.79e-9 SMART
EGF_Lam 515 569 1.58e-3 SMART
EGF_Lam 572 635 5.69e-10 SMART
EGF_Lam 638 688 4.38e-11 SMART
EGF_Lam 691 741 3.56e-11 SMART
EGF_Lam 744 789 7.93e-9 SMART
EGF_Lam 792 841 3.37e-12 SMART
EGF_Lam 844 894 2.01e-10 SMART
EGF_Lam 897 945 5.43e-16 SMART
EGF_Lam 948 996 7.88e-4 SMART
EGF_Lam 999 1047 2.96e-8 SMART
FN3 1051 1130 1e-1 SMART
FN3 1145 1224 2.06e-3 SMART
FN3 1239 1342 8.69e-11 SMART
FN3 1356 1447 5.32e-6 SMART
FN3 1461 1570 2.63e1 SMART
LamG 1531 1672 5.39e-19 SMART
LamG 1727 1862 2.33e-23 SMART
FN3 1861 1931 9.15e1 SMART
FN3 1945 2032 2.24e-4 SMART
FN3 2047 2120 1.13e0 SMART
FN3 2134 2218 3.4e-4 SMART
FN3 2232 2306 1.59e-4 SMART
FN3 2320 2412 1.12e-4 SMART
FN3 2423 2510 8.9e-8 SMART
FN3 2524 2600 1.95e-4 SMART
FN3 2612 2701 4.67e-2 SMART
FN3 2715 2792 1.17e-7 SMART
FN3 2809 2902 1.12e-4 SMART
FN3 2913 2997 5.36e-2 SMART
FN3 3011 3089 2.46e-1 SMART
FN3 3101 3477 2.85e1 SMART
FN3 3491 3568 4e-1 SMART
FN3 3582 3659 5.87e-8 SMART
FN3 3673 3750 1.75e-6 SMART
FN3 3764 3845 9.62e-4 SMART
FN3 3859 3943 2.41e-4 SMART
FN3 3954 4044 5.11e-8 SMART
FN3 4058 4133 1.06e0 SMART
FN3 4147 4241 7.87e-9 SMART
FN3 4255 4334 1.15e-1 SMART
FN3 4348 4422 6.39e-9 SMART
FN3 4435 4510 6.91e-5 SMART
FN3 4521 4610 2.28e-5 SMART
FN3 4626 4713 1.71e0 SMART
FN3 4724 4805 1.3e0 SMART
FN3 4817 4909 3.62e-8 SMART
transmembrane domain 5032 5054 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142159
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display progressive retinal photoreceptor degeneration along with significantly reduced a- and b-wave amplitudes, and a moderate but nonprogressive high-frequency hearing loss associated with widespread loss of outer hair cells in the basal turn of the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930507D05Rik C T 10: 62,285,441 (GRCm39) A55V unknown Het
Adra1b T G 11: 43,667,028 (GRCm39) D403A probably benign Het
Ankdd1b A T 13: 96,597,405 (GRCm39) L9Q probably damaging Het
Ankrd17 A T 5: 90,426,204 (GRCm39) S789R possibly damaging Het
B3galnt1 A G 3: 69,482,326 (GRCm39) S312P probably damaging Het
C4bp C T 1: 130,583,750 (GRCm39) V73M probably damaging Het
Ccdc121rt2 T C 5: 112,598,019 (GRCm39) S189P probably benign Het
Cenpe T A 3: 134,957,305 (GRCm39) N1854K probably damaging Het
Chrm2 A C 6: 36,500,674 (GRCm39) Y177S probably damaging Het
Clca4b C T 3: 144,633,996 (GRCm39) V140I probably benign Het
Csad A G 15: 102,087,958 (GRCm39) S322P probably damaging Het
Depdc1b T G 13: 108,493,956 (GRCm39) Y115D probably damaging Het
Dnah17 T C 11: 118,020,023 (GRCm39) Y8C probably damaging Het
Dsg3 T C 18: 20,656,817 (GRCm39) probably null Het
Elf5 A G 2: 103,269,697 (GRCm39) T93A possibly damaging Het
Eogt C T 6: 97,122,353 (GRCm39) D27N possibly damaging Het
Fam118b T C 9: 35,146,633 (GRCm39) D78G probably damaging Het
Fhip2a T A 19: 57,370,166 (GRCm39) M470K probably benign Het
Frem3 A G 8: 81,337,781 (GRCm39) T25A probably benign Het
Gab1 C A 8: 81,515,226 (GRCm39) R364L possibly damaging Het
Golm1 T C 13: 59,813,375 (GRCm39) Y32C probably damaging Het
Has1 A T 17: 18,070,207 (GRCm39) V238E probably damaging Het
Hkdc1 T C 10: 62,219,583 (GRCm39) R907G possibly damaging Het
Igkv4-61 C A 6: 69,394,138 (GRCm39) A31S possibly damaging Het
Krtap24-1 C T 16: 88,408,761 (GRCm39) V122I probably damaging Het
Lrrc10 T G 10: 116,881,616 (GRCm39) L97V probably damaging Het
Map3k20 T A 2: 72,232,457 (GRCm39) M371K probably benign Het
Mis18bp1 A T 12: 65,205,317 (GRCm39) M2K possibly damaging Het
Mob3b T A 4: 34,954,049 (GRCm39) probably null Het
Muc4 A G 16: 32,570,607 (GRCm39) T556A possibly damaging Het
Muc6 A C 7: 141,224,032 (GRCm39) probably benign Het
Ncapg A T 5: 45,839,158 (GRCm39) L519F probably damaging Het
Nfix A G 8: 85,453,778 (GRCm39) S265P probably benign Het
Or13p10 T A 4: 118,522,808 (GRCm39) F31L possibly damaging Het
Or4c121 T C 2: 89,023,823 (GRCm39) K185R probably damaging Het
Or4k49 T C 2: 111,494,817 (GRCm39) V82A probably benign Het
Or52e5 T C 7: 104,719,514 (GRCm39) L280P probably damaging Het
Or8g35 C A 9: 39,381,112 (GRCm39) K303N probably benign Het
Osgin2 T C 4: 16,006,410 (GRCm39) T95A probably benign Het
Parp4 T C 14: 56,858,108 (GRCm39) probably null Het
Pcdh7 G A 5: 57,879,046 (GRCm39) G867D probably damaging Het
Pcdhb22 T C 18: 37,652,959 (GRCm39) S476P possibly damaging Het
Phldb1 A G 9: 44,623,197 (GRCm39) I619T probably damaging Het
Ppp1r13l C T 7: 19,105,256 (GRCm39) R343C probably damaging Het
Rab2b T A 14: 52,506,164 (GRCm39) probably benign Het
Rims2 A T 15: 39,373,092 (GRCm39) E972V probably damaging Het
Slc26a9 G T 1: 131,686,228 (GRCm39) C337F probably benign Het
Spty2d1 A G 7: 46,647,751 (GRCm39) S393P probably damaging Het
Stkld1 A T 2: 26,831,093 (GRCm39) N90I possibly damaging Het
Svep1 T A 4: 58,053,126 (GRCm39) R3406S probably benign Het
Svil A T 18: 5,040,171 (GRCm39) D48V probably benign Het
Thsd7a T A 6: 12,555,081 (GRCm39) K268* probably null Het
Tmc6 A G 11: 117,661,326 (GRCm39) L618P probably damaging Het
Tmem231 G A 8: 112,653,524 (GRCm39) probably benign Het
Ube2q2l C A 6: 136,378,099 (GRCm39) D244Y probably damaging Het
Ubn1 A G 16: 4,899,791 (GRCm39) H1101R probably benign Het
Upf2 G A 2: 6,032,150 (GRCm39) V899I unknown Het
Usp25 A T 16: 76,859,330 (GRCm39) D276V probably damaging Het
Vmn2r68 T A 7: 84,882,915 (GRCm39) H279L probably benign Het
Vps13d G A 4: 144,818,850 (GRCm39) R3019W probably damaging Het
Vsig10 A T 5: 117,486,361 (GRCm39) E423D probably benign Het
Wdfy2 T A 14: 63,162,582 (GRCm39) F95I probably benign Het
Xrn1 A G 9: 95,915,763 (GRCm39) probably null Het
Zdhhc13 A G 7: 48,461,149 (GRCm39) T362A possibly damaging Het
Zfp984 C T 4: 147,845,703 (GRCm39) S2N probably benign Het
Other mutations in Ush2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ush2a APN 1 188,596,875 (GRCm39) missense probably benign 0.00
IGL00391:Ush2a APN 1 188,648,258 (GRCm39) missense probably damaging 1.00
IGL00429:Ush2a APN 1 188,132,311 (GRCm39) nonsense probably null
IGL00484:Ush2a APN 1 188,514,710 (GRCm39) missense probably benign 0.00
IGL00519:Ush2a APN 1 188,176,865 (GRCm39) missense probably benign 0.03
IGL00567:Ush2a APN 1 188,697,114 (GRCm39) missense probably damaging 1.00
IGL00823:Ush2a APN 1 188,643,640 (GRCm39) missense possibly damaging 0.61
IGL00940:Ush2a APN 1 188,090,158 (GRCm39) nonsense probably null
IGL00951:Ush2a APN 1 187,995,662 (GRCm39) missense probably benign 0.33
IGL00956:Ush2a APN 1 188,485,719 (GRCm39) missense probably damaging 0.99
IGL01096:Ush2a APN 1 188,410,574 (GRCm39) missense probably damaging 1.00
IGL01108:Ush2a APN 1 188,595,022 (GRCm39) missense probably benign 0.00
IGL01315:Ush2a APN 1 188,365,811 (GRCm39) missense possibly damaging 0.51
IGL01318:Ush2a APN 1 188,546,550 (GRCm39) missense probably benign 0.00
IGL01324:Ush2a APN 1 188,581,189 (GRCm39) missense probably benign 0.38
IGL01326:Ush2a APN 1 187,995,518 (GRCm39) nonsense probably null
IGL01384:Ush2a APN 1 188,285,425 (GRCm39) missense possibly damaging 0.65
IGL01466:Ush2a APN 1 188,643,819 (GRCm39) missense probably benign 0.00
IGL01518:Ush2a APN 1 188,131,982 (GRCm39) missense probably benign 0.01
IGL01585:Ush2a APN 1 188,162,924 (GRCm39) missense probably damaging 1.00
IGL01595:Ush2a APN 1 188,386,921 (GRCm39) critical splice donor site probably null
IGL01657:Ush2a APN 1 188,558,658 (GRCm39) missense probably benign 0.03
IGL01797:Ush2a APN 1 187,995,706 (GRCm39) missense probably damaging 1.00
IGL01802:Ush2a APN 1 188,169,154 (GRCm39) missense probably damaging 0.99
IGL01836:Ush2a APN 1 188,492,060 (GRCm39) splice site probably benign
IGL01938:Ush2a APN 1 188,530,042 (GRCm39) missense probably damaging 1.00
IGL01976:Ush2a APN 1 188,643,438 (GRCm39) missense probably benign 0.04
IGL02023:Ush2a APN 1 188,465,711 (GRCm39) missense probably benign 0.03
IGL02126:Ush2a APN 1 187,995,588 (GRCm39) missense probably benign 0.01
IGL02133:Ush2a APN 1 188,175,540 (GRCm39) missense probably damaging 1.00
IGL02147:Ush2a APN 1 188,596,900 (GRCm39) missense probably benign
IGL02275:Ush2a APN 1 187,995,466 (GRCm39) missense possibly damaging 0.67
IGL02314:Ush2a APN 1 188,365,826 (GRCm39) missense probably benign 0.00
IGL02353:Ush2a APN 1 188,460,635 (GRCm39) missense probably benign 0.04
IGL02360:Ush2a APN 1 188,460,635 (GRCm39) missense probably benign 0.04
IGL02367:Ush2a APN 1 188,516,943 (GRCm39) missense probably benign
IGL02402:Ush2a APN 1 187,999,305 (GRCm39) missense probably benign 0.02
IGL02410:Ush2a APN 1 188,648,194 (GRCm39) missense probably damaging 1.00
IGL02490:Ush2a APN 1 188,542,561 (GRCm39) missense probably damaging 1.00
IGL02500:Ush2a APN 1 188,554,893 (GRCm39) missense probably damaging 1.00
IGL02511:Ush2a APN 1 188,475,884 (GRCm39) critical splice donor site probably null
IGL02517:Ush2a APN 1 188,648,195 (GRCm39) missense probably damaging 1.00
IGL02536:Ush2a APN 1 188,689,463 (GRCm39) critical splice acceptor site probably null
IGL02585:Ush2a APN 1 188,460,530 (GRCm39) missense probably benign 0.00
IGL02610:Ush2a APN 1 188,176,663 (GRCm39) missense probably damaging 0.98
IGL02677:Ush2a APN 1 188,466,882 (GRCm39) missense probably damaging 1.00
IGL02691:Ush2a APN 1 188,466,949 (GRCm39) missense probably damaging 1.00
IGL02740:Ush2a APN 1 188,380,585 (GRCm39) missense possibly damaging 0.68
IGL02744:Ush2a APN 1 188,090,914 (GRCm39) splice site probably null
IGL02749:Ush2a APN 1 188,679,155 (GRCm39) missense probably damaging 0.99
IGL02806:Ush2a APN 1 188,542,554 (GRCm39) nonsense probably null
IGL02870:Ush2a APN 1 188,410,555 (GRCm39) missense probably benign 0.42
IGL02894:Ush2a APN 1 188,184,043 (GRCm39) missense probably damaging 1.00
IGL02904:Ush2a APN 1 188,638,703 (GRCm39) missense probably benign 0.06
IGL03000:Ush2a APN 1 188,282,053 (GRCm39) missense possibly damaging 0.81
IGL03015:Ush2a APN 1 188,169,147 (GRCm39) missense probably benign 0.01
IGL03036:Ush2a APN 1 188,596,818 (GRCm39) missense possibly damaging 0.80
IGL03057:Ush2a APN 1 188,530,035 (GRCm39) missense probably damaging 1.00
IGL03230:Ush2a APN 1 188,198,390 (GRCm39) missense probably benign 0.09
IGL03278:Ush2a APN 1 188,581,313 (GRCm39) missense probably damaging 1.00
BB003:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
BB013:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
PIT4283001:Ush2a UTSW 1 188,169,064 (GRCm39) missense probably benign 0.01
R0003:Ush2a UTSW 1 188,310,688 (GRCm39) missense probably damaging 0.99
R0030:Ush2a UTSW 1 188,554,854 (GRCm39) missense possibly damaging 0.51
R0035:Ush2a UTSW 1 188,089,085 (GRCm39) missense probably benign
R0038:Ush2a UTSW 1 188,358,809 (GRCm39) missense probably benign 0.00
R0038:Ush2a UTSW 1 188,358,809 (GRCm39) missense probably benign 0.00
R0067:Ush2a UTSW 1 188,697,043 (GRCm39) missense probably damaging 0.99
R0067:Ush2a UTSW 1 188,697,043 (GRCm39) missense probably damaging 0.99
R0103:Ush2a UTSW 1 188,051,267 (GRCm39) missense possibly damaging 0.81
R0103:Ush2a UTSW 1 188,051,267 (GRCm39) missense possibly damaging 0.81
R0122:Ush2a UTSW 1 188,680,652 (GRCm39) missense possibly damaging 0.65
R0206:Ush2a UTSW 1 188,263,958 (GRCm39) missense probably damaging 0.99
R0208:Ush2a UTSW 1 188,263,958 (GRCm39) missense probably damaging 0.99
R0230:Ush2a UTSW 1 188,582,301 (GRCm39) missense probably damaging 1.00
R0269:Ush2a UTSW 1 188,542,373 (GRCm39) missense probably benign 0.33
R0319:Ush2a UTSW 1 188,680,571 (GRCm39) splice site probably benign
R0358:Ush2a UTSW 1 188,269,977 (GRCm39) missense possibly damaging 0.83
R0379:Ush2a UTSW 1 188,184,016 (GRCm39) missense probably damaging 1.00
R0427:Ush2a UTSW 1 188,132,478 (GRCm39) missense probably damaging 1.00
R0437:Ush2a UTSW 1 188,643,228 (GRCm39) missense probably benign 0.00
R0462:Ush2a UTSW 1 188,643,136 (GRCm39) missense probably benign
R0510:Ush2a UTSW 1 188,466,860 (GRCm39) splice site probably benign
R0531:Ush2a UTSW 1 188,175,378 (GRCm39) missense probably benign 0.18
R0541:Ush2a UTSW 1 188,446,663 (GRCm39) splice site probably benign
R0549:Ush2a UTSW 1 188,679,150 (GRCm39) missense probably damaging 0.99
R0562:Ush2a UTSW 1 188,089,044 (GRCm39) missense probably damaging 1.00
R0636:Ush2a UTSW 1 188,554,935 (GRCm39) missense probably benign
R0662:Ush2a UTSW 1 188,083,290 (GRCm39) missense probably benign 0.26
R0685:Ush2a UTSW 1 188,132,475 (GRCm39) missense probably damaging 1.00
R0718:Ush2a UTSW 1 188,530,027 (GRCm39) missense probably damaging 1.00
R0725:Ush2a UTSW 1 188,683,722 (GRCm39) missense probably damaging 1.00
R0735:Ush2a UTSW 1 188,596,890 (GRCm39) missense probably benign 0.04
R0744:Ush2a UTSW 1 188,546,603 (GRCm39) splice site probably benign
R0765:Ush2a UTSW 1 188,680,771 (GRCm39) missense possibly damaging 0.67
R0862:Ush2a UTSW 1 188,275,015 (GRCm39) nonsense probably null
R1067:Ush2a UTSW 1 188,282,404 (GRCm39) missense probably benign 0.35
R1072:Ush2a UTSW 1 188,460,914 (GRCm39) missense possibly damaging 0.91
R1099:Ush2a UTSW 1 188,596,836 (GRCm39) missense probably damaging 1.00
R1099:Ush2a UTSW 1 188,380,545 (GRCm39) missense probably benign 0.06
R1104:Ush2a UTSW 1 188,648,453 (GRCm39) missense probably benign
R1106:Ush2a UTSW 1 188,643,180 (GRCm39) missense possibly damaging 0.82
R1124:Ush2a UTSW 1 188,485,733 (GRCm39) missense probably damaging 0.99
R1168:Ush2a UTSW 1 188,410,608 (GRCm39) missense probably benign 0.01
R1199:Ush2a UTSW 1 188,491,992 (GRCm39) missense probably benign 0.00
R1215:Ush2a UTSW 1 188,689,479 (GRCm39) missense possibly damaging 0.66
R1307:Ush2a UTSW 1 188,184,037 (GRCm39) missense probably damaging 1.00
R1307:Ush2a UTSW 1 188,090,164 (GRCm39) missense probably damaging 1.00
R1311:Ush2a UTSW 1 188,679,342 (GRCm39) missense possibly damaging 0.86
R1388:Ush2a UTSW 1 188,255,515 (GRCm39) splice site probably benign
R1416:Ush2a UTSW 1 188,169,080 (GRCm39) missense probably damaging 1.00
R1424:Ush2a UTSW 1 188,275,075 (GRCm39) critical splice donor site probably null
R1459:Ush2a UTSW 1 188,595,048 (GRCm39) missense probably benign 0.05
R1470:Ush2a UTSW 1 188,132,403 (GRCm39) missense probably benign 0.00
R1470:Ush2a UTSW 1 188,132,403 (GRCm39) missense probably benign 0.00
R1477:Ush2a UTSW 1 188,581,273 (GRCm39) missense probably benign 0.05
R1484:Ush2a UTSW 1 188,542,534 (GRCm39) nonsense probably null
R1490:Ush2a UTSW 1 188,092,038 (GRCm39) missense probably benign 0.24
R1510:Ush2a UTSW 1 188,380,501 (GRCm39) missense probably damaging 1.00
R1522:Ush2a UTSW 1 188,530,011 (GRCm39) missense possibly damaging 0.94
R1606:Ush2a UTSW 1 188,491,963 (GRCm39) missense probably benign 0.17
R1618:Ush2a UTSW 1 188,546,421 (GRCm39) missense probably benign 0.29
R1636:Ush2a UTSW 1 188,198,373 (GRCm39) missense possibly damaging 0.53
R1646:Ush2a UTSW 1 188,148,018 (GRCm39) missense probably damaging 1.00
R1660:Ush2a UTSW 1 188,648,261 (GRCm39) missense probably benign
R1676:Ush2a UTSW 1 188,460,782 (GRCm39) missense probably damaging 1.00
R1704:Ush2a UTSW 1 188,553,993 (GRCm39) missense probably damaging 1.00
R1705:Ush2a UTSW 1 188,643,738 (GRCm39) missense probably benign 0.40
R1705:Ush2a UTSW 1 188,607,066 (GRCm39) missense probably damaging 1.00
R1760:Ush2a UTSW 1 188,643,180 (GRCm39) missense possibly damaging 0.82
R1776:Ush2a UTSW 1 188,460,400 (GRCm39) missense possibly damaging 0.83
R1782:Ush2a UTSW 1 188,643,382 (GRCm39) missense probably benign 0.06
R1794:Ush2a UTSW 1 188,595,006 (GRCm39) missense probably benign 0.00
R1796:Ush2a UTSW 1 188,643,024 (GRCm39) missense probably benign 0.11
R1804:Ush2a UTSW 1 188,365,926 (GRCm39) critical splice donor site probably null
R1835:Ush2a UTSW 1 188,184,015 (GRCm39) missense probably benign 0.13
R1871:Ush2a UTSW 1 188,558,665 (GRCm39) missense probably benign 0.02
R1876:Ush2a UTSW 1 188,410,486 (GRCm39) missense possibly damaging 0.51
R1887:Ush2a UTSW 1 188,132,177 (GRCm39) missense probably benign 0.05
R1896:Ush2a UTSW 1 188,282,206 (GRCm39) missense probably benign 0.00
R1907:Ush2a UTSW 1 188,447,261 (GRCm39) missense probably benign 0.01
R1940:Ush2a UTSW 1 188,683,758 (GRCm39) missense probably null 0.89
R1950:Ush2a UTSW 1 188,487,382 (GRCm39) missense probably damaging 1.00
R1991:Ush2a UTSW 1 188,310,729 (GRCm39) splice site probably benign
R2043:Ush2a UTSW 1 188,648,453 (GRCm39) missense probably benign 0.00
R2046:Ush2a UTSW 1 188,089,124 (GRCm39) missense probably benign 0.01
R2059:Ush2a UTSW 1 188,113,746 (GRCm39) critical splice donor site probably null
R2239:Ush2a UTSW 1 188,308,411 (GRCm39) missense probably benign
R2365:Ush2a UTSW 1 188,111,188 (GRCm39) missense possibly damaging 0.68
R2395:Ush2a UTSW 1 188,679,237 (GRCm39) missense probably damaging 1.00
R2425:Ush2a UTSW 1 188,270,001 (GRCm39) missense possibly damaging 0.82
R2519:Ush2a UTSW 1 187,999,304 (GRCm39) missense probably benign
R3039:Ush2a UTSW 1 188,643,744 (GRCm39) missense probably damaging 0.99
R3434:Ush2a UTSW 1 188,465,955 (GRCm39) missense probably damaging 1.00
R3711:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3712:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3732:Ush2a UTSW 1 188,676,957 (GRCm39) missense probably benign 0.16
R3746:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3747:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3883:Ush2a UTSW 1 187,995,579 (GRCm39) missense probably benign
R3911:Ush2a UTSW 1 188,132,151 (GRCm39) missense probably benign 0.05
R3934:Ush2a UTSW 1 187,995,708 (GRCm39) critical splice donor site probably null
R3946:Ush2a UTSW 1 188,460,701 (GRCm39) missense probably benign 0.01
R3974:Ush2a UTSW 1 188,113,698 (GRCm39) missense probably benign 0.06
R4158:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4159:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4161:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4162:Ush2a UTSW 1 188,475,877 (GRCm39) missense probably benign 0.00
R4255:Ush2a UTSW 1 188,492,040 (GRCm39) nonsense probably null
R4280:Ush2a UTSW 1 188,310,658 (GRCm39) missense probably benign 0.16
R4387:Ush2a UTSW 1 188,175,628 (GRCm39) missense probably benign 0.00
R4416:Ush2a UTSW 1 188,089,071 (GRCm39) missense probably damaging 0.97
R4494:Ush2a UTSW 1 188,285,473 (GRCm39) missense possibly damaging 0.50
R4505:Ush2a UTSW 1 188,460,793 (GRCm39) missense possibly damaging 0.92
R4522:Ush2a UTSW 1 188,596,822 (GRCm39) missense probably damaging 1.00
R4584:Ush2a UTSW 1 188,183,995 (GRCm39) missense probably benign 0.00
R4599:Ush2a UTSW 1 188,643,844 (GRCm39) missense probably benign 0.01
R4605:Ush2a UTSW 1 188,642,998 (GRCm39) missense probably damaging 1.00
R4632:Ush2a UTSW 1 188,128,071 (GRCm39) missense possibly damaging 0.82
R4688:Ush2a UTSW 1 188,132,138 (GRCm39) missense probably benign 0.01
R4751:Ush2a UTSW 1 188,582,284 (GRCm39) missense probably damaging 0.98
R4770:Ush2a UTSW 1 188,282,076 (GRCm39) missense probably benign 0.25
R4771:Ush2a UTSW 1 188,529,966 (GRCm39) missense possibly damaging 0.92
R4798:Ush2a UTSW 1 188,475,742 (GRCm39) missense probably damaging 1.00
R4821:Ush2a UTSW 1 188,485,848 (GRCm39) missense probably benign 0.32
R4857:Ush2a UTSW 1 188,269,917 (GRCm39) missense probably benign 0.01
R4860:Ush2a UTSW 1 188,285,472 (GRCm39) missense probably benign 0.07
R4860:Ush2a UTSW 1 188,285,472 (GRCm39) missense probably benign 0.07
R4898:Ush2a UTSW 1 188,358,805 (GRCm39) missense probably benign 0.37
R4993:Ush2a UTSW 1 188,642,917 (GRCm39) missense probably benign 0.03
R5035:Ush2a UTSW 1 188,643,005 (GRCm39) missense probably damaging 1.00
R5061:Ush2a UTSW 1 188,689,471 (GRCm39) missense probably benign 0.03
R5150:Ush2a UTSW 1 188,184,067 (GRCm39) missense possibly damaging 0.95
R5205:Ush2a UTSW 1 188,607,133 (GRCm39) missense probably benign 0.21
R5212:Ush2a UTSW 1 188,176,902 (GRCm39) critical splice donor site probably null
R5252:Ush2a UTSW 1 188,553,914 (GRCm39) missense possibly damaging 0.83
R5260:Ush2a UTSW 1 188,679,276 (GRCm39) missense possibly damaging 0.95
R5304:Ush2a UTSW 1 188,088,995 (GRCm39) missense probably damaging 0.99
R5323:Ush2a UTSW 1 188,553,874 (GRCm39) critical splice acceptor site probably null
R5330:Ush2a UTSW 1 188,460,578 (GRCm39) missense probably benign 0.00
R5331:Ush2a UTSW 1 188,460,578 (GRCm39) missense probably benign 0.00
R5332:Ush2a UTSW 1 188,083,276 (GRCm39) missense probably damaging 1.00
R5371:Ush2a UTSW 1 188,175,267 (GRCm39) missense probably benign 0.00
R5374:Ush2a UTSW 1 188,487,403 (GRCm39) missense probably benign
R5377:Ush2a UTSW 1 188,644,320 (GRCm39) missense probably benign 0.00
R5525:Ush2a UTSW 1 188,485,803 (GRCm39) missense probably benign 0.01
R5558:Ush2a UTSW 1 188,530,024 (GRCm39) missense possibly damaging 0.47
R5562:Ush2a UTSW 1 188,308,414 (GRCm39) missense probably damaging 1.00
R5595:Ush2a UTSW 1 188,638,695 (GRCm39) missense possibly damaging 0.95
R5620:Ush2a UTSW 1 188,492,020 (GRCm39) missense possibly damaging 0.82
R5714:Ush2a UTSW 1 188,132,454 (GRCm39) missense probably benign 0.00
R5743:Ush2a UTSW 1 188,169,159 (GRCm39) missense probably benign 0.01
R5779:Ush2a UTSW 1 188,175,707 (GRCm39) critical splice donor site probably null
R5795:Ush2a UTSW 1 188,175,594 (GRCm39) missense probably benign 0.34
R5897:Ush2a UTSW 1 188,553,935 (GRCm39) missense probably damaging 1.00
R5918:Ush2a UTSW 1 188,089,011 (GRCm39) missense probably benign 0.26
R6000:Ush2a UTSW 1 187,999,223 (GRCm39) nonsense probably null
R6014:Ush2a UTSW 1 188,582,237 (GRCm39) missense probably damaging 0.98
R6017:Ush2a UTSW 1 188,689,711 (GRCm39) critical splice donor site probably null
R6020:Ush2a UTSW 1 188,460,293 (GRCm39) splice site probably null
R6039:Ush2a UTSW 1 188,051,217 (GRCm39) missense possibly damaging 0.76
R6039:Ush2a UTSW 1 188,051,217 (GRCm39) missense possibly damaging 0.76
R6050:Ush2a UTSW 1 188,689,521 (GRCm39) missense probably benign 0.06
R6083:Ush2a UTSW 1 187,999,220 (GRCm39) missense probably damaging 1.00
R6091:Ush2a UTSW 1 188,132,000 (GRCm39) missense probably damaging 1.00
R6120:Ush2a UTSW 1 188,090,800 (GRCm39) missense probably benign 0.04
R6135:Ush2a UTSW 1 188,644,303 (GRCm39) missense possibly damaging 0.68
R6141:Ush2a UTSW 1 188,090,160 (GRCm39) missense possibly damaging 0.71
R6157:Ush2a UTSW 1 188,460,467 (GRCm39) missense probably benign 0.00
R6180:Ush2a UTSW 1 188,132,068 (GRCm39) nonsense probably null
R6191:Ush2a UTSW 1 187,995,298 (GRCm39) nonsense probably null
R6217:Ush2a UTSW 1 188,475,651 (GRCm39) splice site probably null
R6263:Ush2a UTSW 1 188,090,839 (GRCm39) missense probably damaging 1.00
R6294:Ush2a UTSW 1 188,268,567 (GRCm39) missense possibly damaging 0.49
R6320:Ush2a UTSW 1 188,089,043 (GRCm39) missense probably benign 0.01
R6321:Ush2a UTSW 1 188,581,243 (GRCm39) nonsense probably null
R6347:Ush2a UTSW 1 188,643,084 (GRCm39) missense probably benign
R6382:Ush2a UTSW 1 188,546,499 (GRCm39) missense probably benign 0.01
R6408:Ush2a UTSW 1 187,999,229 (GRCm39) nonsense probably null
R6500:Ush2a UTSW 1 188,573,724 (GRCm39) missense probably benign 0.00
R6504:Ush2a UTSW 1 188,643,444 (GRCm39) missense probably benign 0.00
R6534:Ush2a UTSW 1 188,183,999 (GRCm39) nonsense probably null
R6594:Ush2a UTSW 1 188,642,995 (GRCm39) missense possibly damaging 0.93
R6612:Ush2a UTSW 1 188,643,594 (GRCm39) missense possibly damaging 0.91
R6645:Ush2a UTSW 1 188,255,528 (GRCm39) missense probably damaging 0.99
R6658:Ush2a UTSW 1 188,546,556 (GRCm39) missense possibly damaging 0.95
R6726:Ush2a UTSW 1 188,485,881 (GRCm39) missense possibly damaging 0.85
R6755:Ush2a UTSW 1 188,175,416 (GRCm39) missense possibly damaging 0.95
R6782:Ush2a UTSW 1 188,089,031 (GRCm39) missense probably benign
R6817:Ush2a UTSW 1 188,595,061 (GRCm39) missense probably benign 0.03
R6834:Ush2a UTSW 1 188,088,989 (GRCm39) missense probably damaging 1.00
R6851:Ush2a UTSW 1 188,265,402 (GRCm39) missense probably benign 0.06
R6853:Ush2a UTSW 1 188,643,434 (GRCm39) nonsense probably null
R6867:Ush2a UTSW 1 188,643,170 (GRCm39) missense probably damaging 1.00
R6889:Ush2a UTSW 1 188,530,068 (GRCm39) missense probably damaging 1.00
R6931:Ush2a UTSW 1 188,460,580 (GRCm39) missense probably benign 0.01
R6953:Ush2a UTSW 1 187,995,342 (GRCm39) missense possibly damaging 0.94
R6966:Ush2a UTSW 1 188,308,441 (GRCm39) missense probably damaging 1.00
R7109:Ush2a UTSW 1 188,113,681 (GRCm39) missense probably benign 0.19
R7153:Ush2a UTSW 1 188,460,681 (GRCm39) missense possibly damaging 0.93
R7176:Ush2a UTSW 1 188,269,925 (GRCm39) missense probably benign 0.00
R7182:Ush2a UTSW 1 188,485,740 (GRCm39) missense probably benign 0.01
R7201:Ush2a UTSW 1 188,606,951 (GRCm39) missense probably benign
R7223:Ush2a UTSW 1 188,542,414 (GRCm39) missense probably benign 0.09
R7231:Ush2a UTSW 1 188,491,960 (GRCm39) missense possibly damaging 0.49
R7240:Ush2a UTSW 1 188,643,858 (GRCm39) missense possibly damaging 0.83
R7263:Ush2a UTSW 1 188,175,526 (GRCm39) missense possibly damaging 0.94
R7329:Ush2a UTSW 1 188,285,395 (GRCm39) missense probably damaging 0.97
R7343:Ush2a UTSW 1 188,147,943 (GRCm39) missense probably benign 0.00
R7352:Ush2a UTSW 1 188,198,321 (GRCm39) missense probably benign 0.04
R7384:Ush2a UTSW 1 188,132,360 (GRCm39) missense probably damaging 0.99
R7391:Ush2a UTSW 1 188,694,205 (GRCm39) small deletion probably benign
R7394:Ush2a UTSW 1 188,643,613 (GRCm39) missense possibly damaging 0.83
R7403:Ush2a UTSW 1 188,365,924 (GRCm39) missense probably damaging 1.00
R7408:Ush2a UTSW 1 188,465,726 (GRCm39) missense probably benign 0.00
R7453:Ush2a UTSW 1 188,285,308 (GRCm39) missense probably damaging 1.00
R7496:Ush2a UTSW 1 188,083,284 (GRCm39) missense possibly damaging 0.50
R7552:Ush2a UTSW 1 187,999,241 (GRCm39) missense possibly damaging 0.65
R7556:Ush2a UTSW 1 188,689,690 (GRCm39) missense probably benign 0.31
R7575:Ush2a UTSW 1 188,554,885 (GRCm39) missense possibly damaging 0.90
R7578:Ush2a UTSW 1 188,282,110 (GRCm39) missense probably damaging 1.00
R7584:Ush2a UTSW 1 188,460,306 (GRCm39) critical splice acceptor site probably null
R7589:Ush2a UTSW 1 188,275,046 (GRCm39) missense probably benign 0.00
R7602:Ush2a UTSW 1 188,380,606 (GRCm39) missense probably damaging 1.00
R7670:Ush2a UTSW 1 188,516,905 (GRCm39) missense possibly damaging 0.78
R7743:Ush2a UTSW 1 188,542,376 (GRCm39) missense probably benign 0.05
R7753:Ush2a UTSW 1 188,175,603 (GRCm39) missense probably benign 0.28
R7767:Ush2a UTSW 1 188,285,457 (GRCm39) missense probably benign 0.01
R7784:Ush2a UTSW 1 188,176,789 (GRCm39) missense possibly damaging 0.55
R7831:Ush2a UTSW 1 188,492,038 (GRCm39) missense probably damaging 0.98
R7834:Ush2a UTSW 1 188,465,637 (GRCm39) nonsense probably null
R7847:Ush2a UTSW 1 188,163,005 (GRCm39) missense probably damaging 1.00
R7926:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
R7969:Ush2a UTSW 1 188,558,568 (GRCm39) missense probably benign 0.02
R7978:Ush2a UTSW 1 188,132,135 (GRCm39) missense probably benign 0.00
R7990:Ush2a UTSW 1 188,274,996 (GRCm39) missense probably benign 0.00
R8001:Ush2a UTSW 1 188,643,261 (GRCm39) missense probably damaging 0.98
R8039:Ush2a UTSW 1 188,689,570 (GRCm39) missense probably damaging 1.00
R8077:Ush2a UTSW 1 188,275,025 (GRCm39) missense probably benign 0.01
R8165:Ush2a UTSW 1 188,183,952 (GRCm39) missense possibly damaging 0.70
R8208:Ush2a UTSW 1 188,606,990 (GRCm39) missense possibly damaging 0.95
R8220:Ush2a UTSW 1 188,460,863 (GRCm39) missense probably damaging 1.00
R8270:Ush2a UTSW 1 188,176,838 (GRCm39) missense probably benign 0.06
R8316:Ush2a UTSW 1 188,178,899 (GRCm39) missense probably benign 0.01
R8347:Ush2a UTSW 1 188,679,281 (GRCm39) missense probably benign 0.02
R8360:Ush2a UTSW 1 188,198,468 (GRCm39) missense probably benign 0.01
R8362:Ush2a UTSW 1 188,689,650 (GRCm39) missense probably damaging 0.96
R8386:Ush2a UTSW 1 188,460,403 (GRCm39) missense possibly damaging 0.80
R8401:Ush2a UTSW 1 188,275,062 (GRCm39) missense probably benign 0.10
R8439:Ush2a UTSW 1 188,582,254 (GRCm39) missense probably damaging 1.00
R8465:Ush2a UTSW 1 188,147,875 (GRCm39) missense probably damaging 1.00
R8478:Ush2a UTSW 1 188,175,429 (GRCm39) missense possibly damaging 0.83
R8540:Ush2a UTSW 1 188,274,858 (GRCm39) missense probably benign 0.00
R8684:Ush2a UTSW 1 188,643,220 (GRCm39) missense possibly damaging 0.45
R8685:Ush2a UTSW 1 188,198,401 (GRCm39) missense probably damaging 1.00
R8699:Ush2a UTSW 1 188,643,574 (GRCm39) missense probably damaging 1.00
R8720:Ush2a UTSW 1 188,090,715 (GRCm39) missense probably benign 0.05
R8754:Ush2a UTSW 1 188,581,162 (GRCm39) nonsense probably null
R8756:Ush2a UTSW 1 188,644,141 (GRCm39) missense possibly damaging 0.91
R8788:Ush2a UTSW 1 188,475,816 (GRCm39) nonsense probably null
R8803:Ush2a UTSW 1 188,676,998 (GRCm39) missense probably benign
R8817:Ush2a UTSW 1 187,995,231 (GRCm39) start codon destroyed probably benign 0.00
R8837:Ush2a UTSW 1 188,485,847 (GRCm39) missense probably benign
R8880:Ush2a UTSW 1 188,460,733 (GRCm39) missense probably benign 0.11
R8902:Ush2a UTSW 1 188,175,281 (GRCm39) missense probably damaging 0.98
R8918:Ush2a UTSW 1 188,270,017 (GRCm39) missense possibly damaging 0.85
R8940:Ush2a UTSW 1 188,132,505 (GRCm39) missense probably benign 0.02
R8968:Ush2a UTSW 1 188,127,956 (GRCm39) missense probably damaging 1.00
R8995:Ush2a UTSW 1 188,176,850 (GRCm39) missense probably damaging 0.98
R9011:Ush2a UTSW 1 188,638,676 (GRCm39) missense probably damaging 0.99
R9037:Ush2a UTSW 1 187,995,487 (GRCm39) missense possibly damaging 0.51
R9063:Ush2a UTSW 1 187,995,457 (GRCm39) missense probably benign 0.00
R9089:Ush2a UTSW 1 188,487,374 (GRCm39) nonsense probably null
R9096:Ush2a UTSW 1 188,198,333 (GRCm39) missense probably benign 0.00
R9118:Ush2a UTSW 1 188,386,839 (GRCm39) missense probably damaging 0.98
R9174:Ush2a UTSW 1 188,460,416 (GRCm39) missense probably damaging 0.99
R9210:Ush2a UTSW 1 188,516,866 (GRCm39) missense probably null 0.01
R9242:Ush2a UTSW 1 188,365,787 (GRCm39) missense probably damaging 1.00
R9321:Ush2a UTSW 1 188,089,148 (GRCm39) missense probably damaging 0.97
R9338:Ush2a UTSW 1 188,308,489 (GRCm39) critical splice donor site probably null
R9357:Ush2a UTSW 1 188,607,147 (GRCm39) missense probably benign 0.01
R9358:Ush2a UTSW 1 188,607,147 (GRCm39) missense probably benign 0.01
R9406:Ush2a UTSW 1 187,995,646 (GRCm39) missense probably benign 0.00
R9407:Ush2a UTSW 1 188,644,045 (GRCm39) missense probably damaging 1.00
R9428:Ush2a UTSW 1 188,175,316 (GRCm39) missense probably damaging 1.00
R9456:Ush2a UTSW 1 188,558,589 (GRCm39) missense probably benign 0.00
R9507:Ush2a UTSW 1 188,596,937 (GRCm39) nonsense probably null
R9509:Ush2a UTSW 1 188,648,440 (GRCm39) missense probably damaging 1.00
R9512:Ush2a UTSW 1 188,643,160 (GRCm39) missense probably damaging 0.99
R9564:Ush2a UTSW 1 188,268,551 (GRCm39) missense possibly damaging 0.90
R9612:Ush2a UTSW 1 188,092,063 (GRCm39) nonsense probably null
R9670:Ush2a UTSW 1 188,360,768 (GRCm39) missense probably benign 0.03
R9684:Ush2a UTSW 1 188,132,078 (GRCm39) missense possibly damaging 0.67
R9798:Ush2a UTSW 1 188,644,002 (GRCm39) missense possibly damaging 0.80
RF017:Ush2a UTSW 1 187,995,666 (GRCm39) missense probably damaging 1.00
U24488:Ush2a UTSW 1 188,162,963 (GRCm39) missense probably damaging 0.99
X0011:Ush2a UTSW 1 188,051,166 (GRCm39) missense probably benign 0.00
X0024:Ush2a UTSW 1 188,132,479 (GRCm39) missense probably damaging 1.00
X0026:Ush2a UTSW 1 188,051,222 (GRCm39) missense possibly damaging 0.94
X0062:Ush2a UTSW 1 188,282,051 (GRCm39) missense probably damaging 1.00
Y4340:Ush2a UTSW 1 188,475,826 (GRCm39) missense possibly damaging 0.87
Y4341:Ush2a UTSW 1 188,475,826 (GRCm39) missense possibly damaging 0.87
Z1088:Ush2a UTSW 1 188,679,201 (GRCm39) missense probably benign 0.26
Z1088:Ush2a UTSW 1 188,644,180 (GRCm39) missense probably benign
Z1176:Ush2a UTSW 1 188,089,038 (GRCm39) missense probably damaging 1.00
Z1177:Ush2a UTSW 1 188,644,407 (GRCm39) missense possibly damaging 0.77
Z1177:Ush2a UTSW 1 188,465,741 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACCGTGTATGTTTTAGAGACAG -3'
(R):5'- GGACAGAAGCTAAGTTGACTTACTC -3'

Sequencing Primer
(F):5'- TGTTTTAGAGACAGTTACATTTGAGC -3'
(R):5'- CTCTCAGCCTGATGAGGTATAGAC -3'
Posted On 2018-05-24