Incidental Mutation 'R6418:Csad'
ID518095
Institutional Source Beutler Lab
Gene Symbol Csad
Ensembl Gene ENSMUSG00000023044
Gene Namecysteine sulfinic acid decarboxylase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6418 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102176999-102204724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102179523 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 322 (S322P)
Ref Sequence ENSEMBL: ENSMUSP00000023805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023805] [ENSMUST00000230288] [ENSMUST00000230322] [ENSMUST00000230708] [ENSMUST00000231048]
Predicted Effect probably damaging
Transcript: ENSMUST00000023805
AA Change: S322P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023805
Gene: ENSMUSG00000023044
AA Change: S322P

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 49 417 1.4e-113 PFAM
Pfam:Aminotran_5 120 281 4.9e-7 PFAM
low complexity region 482 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230253
Predicted Effect possibly damaging
Transcript: ENSMUST00000230288
AA Change: S322P

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000230322
Predicted Effect probably benign
Transcript: ENSMUST00000230342
Predicted Effect probably benign
Transcript: ENSMUST00000230708
Predicted Effect probably benign
Transcript: ENSMUST00000231029
Predicted Effect probably benign
Transcript: ENSMUST00000231048
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group 2 decarboxylase family. A similar protein in rodents plays a role in multiple biological processes as the rate-limiting enzyme in taurine biosynthesis, catalyzing the decarboxylation of cysteinesulfinate to hypotaurine. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930507D05Rik C T 10: 62,449,662 A55V unknown Het
Adra1b T G 11: 43,776,201 D403A probably benign Het
Ankdd1b A T 13: 96,460,897 L9Q probably damaging Het
Ankrd17 A T 5: 90,278,345 S789R possibly damaging Het
B3galnt1 A G 3: 69,574,993 S312P probably damaging Het
C4bp C T 1: 130,656,013 V73M probably damaging Het
Cenpe T A 3: 135,251,544 N1854K probably damaging Het
Chrm2 A C 6: 36,523,739 Y177S probably damaging Het
Clca4b C T 3: 144,928,235 V140I probably benign Het
Depdc1b T G 13: 108,357,422 Y115D probably damaging Het
Dnah17 T C 11: 118,129,197 Y8C probably damaging Het
Dsg3 T C 18: 20,523,760 probably null Het
E330021D16Rik C A 6: 136,401,101 D244Y probably damaging Het
Elf5 A G 2: 103,439,352 T93A possibly damaging Het
Eogt C T 6: 97,145,392 D27N possibly damaging Het
Fam118b T C 9: 35,235,337 D78G probably damaging Het
Fam160b1 T A 19: 57,381,734 M470K probably benign Het
Frem3 A G 8: 80,611,152 T25A probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm6588 T C 5: 112,450,153 S189P probably benign Het
Golm1 T C 13: 59,665,561 Y32C probably damaging Het
Has1 A T 17: 17,849,945 V238E probably damaging Het
Hkdc1 T C 10: 62,383,804 R907G possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Krtap24-1 C T 16: 88,611,873 V122I probably damaging Het
Lrrc10 T G 10: 117,045,711 L97V probably damaging Het
Map3k20 T A 2: 72,402,113 M371K probably benign Het
Mis18bp1 A T 12: 65,158,543 M2K possibly damaging Het
Mob3b T A 4: 34,954,049 probably null Het
Muc4 A G 16: 32,751,789 T556A possibly damaging Het
Muc6 A C 7: 141,639,610 probably benign Het
Ncapg A T 5: 45,681,816 L519F probably damaging Het
Nfix A G 8: 84,727,149 S265P probably benign Het
Olfr1226 T C 2: 89,193,479 K185R probably damaging Het
Olfr1299 T C 2: 111,664,472 V82A probably benign Het
Olfr62 T A 4: 118,665,611 F31L possibly damaging Het
Olfr678 T C 7: 105,070,307 L280P probably damaging Het
Olfr955 C A 9: 39,469,816 K303N probably benign Het
Osgin2 T C 4: 16,006,410 T95A probably benign Het
Parp4 T C 14: 56,620,651 probably null Het
Pcdh7 G A 5: 57,721,704 G867D probably damaging Het
Pcdhb22 T C 18: 37,519,906 S476P possibly damaging Het
Phldb1 A G 9: 44,711,900 I619T probably damaging Het
Ppp1r13l C T 7: 19,371,331 R343C probably damaging Het
Rab2b T A 14: 52,268,707 probably benign Het
Rims2 A T 15: 39,509,696 E972V probably damaging Het
Slc26a9 G T 1: 131,758,490 C337F probably benign Het
Spty2d1 A G 7: 46,998,003 S393P probably damaging Het
Stkld1 A T 2: 26,941,081 N90I possibly damaging Het
Svep1 T A 4: 58,053,126 R3406S probably benign Het
Svil A T 18: 5,040,171 D48V probably benign Het
Thsd7a T A 6: 12,555,082 K268* probably null Het
Tmc6 A G 11: 117,770,500 L618P probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Ubn1 A G 16: 5,081,927 H1101R probably benign Het
Upf2 G A 2: 6,027,339 V899I unknown Het
Ush2a A T 1: 188,628,566 N2161I probably damaging Het
Usp25 A T 16: 77,062,442 D276V probably damaging Het
Vmn2r68 T A 7: 85,233,707 H279L probably benign Het
Vps13d G A 4: 145,092,280 R3019W probably damaging Het
Vsig10 A T 5: 117,348,296 E423D probably benign Het
Wdfy2 T A 14: 62,925,133 F95I probably benign Het
Xrn1 A G 9: 96,033,710 probably null Het
Zdhhc13 A G 7: 48,811,401 T362A possibly damaging Het
Zfp984 C T 4: 147,761,246 S2N probably benign Het
Other mutations in Csad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Csad APN 15 102187163 missense probably damaging 1.00
IGL01769:Csad APN 15 102180081 missense probably benign 0.02
IGL02254:Csad APN 15 102186437 nonsense probably null
dejavu UTSW 15 102179972 missense probably damaging 1.00
dell UTSW 15 102178606 missense probably damaging 1.00
lenovo UTSW 15 102179034 missense probably null 1.00
PIT4382001:Csad UTSW 15 102188650 missense probably benign 0.00
R0701:Csad UTSW 15 102179136 missense probably benign 0.42
R1595:Csad UTSW 15 102177782 missense probably damaging 1.00
R1707:Csad UTSW 15 102179972 missense probably damaging 1.00
R2107:Csad UTSW 15 102179034 missense probably null 1.00
R2196:Csad UTSW 15 102187593 missense probably benign 0.00
R2275:Csad UTSW 15 102187122 missense probably damaging 0.98
R2504:Csad UTSW 15 102188667 start codon destroyed probably null 0.97
R2928:Csad UTSW 15 102177704 missense probably damaging 1.00
R3924:Csad UTSW 15 102178556 missense probably benign 0.05
R6235:Csad UTSW 15 102178606 missense probably damaging 1.00
R7612:Csad UTSW 15 102188922 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AATTCCCTGGGCACATGGAG -3'
(R):5'- GGTTCTCAGGATAGCCACAAAC -3'

Sequencing Primer
(F):5'- TGGGCACATGGAGCTCAAC -3'
(R):5'- ACACGGACAGATGATTGATTTTGG -3'
Posted On2018-05-24