Incidental Mutation 'R6417:Sord'
ID518109
Institutional Source Beutler Lab
Gene Symbol Sord
Ensembl Gene ENSMUSG00000027227
Gene Namesorbitol dehydrogenase
SynonymsSodh-1, Sdh1, Sdh-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122234749-122265340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122264121 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 330 (K330M)
Ref Sequence ENSEMBL: ENSMUSP00000106180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110551]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110551
AA Change: K330M

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106180
Gene: ENSMUSG00000027227
AA Change: K330M

DomainStartEndE-ValueType
Pfam:ADH_N 32 143 1.3e-24 PFAM
Pfam:Glu_dehyd_C 149 349 5.1e-12 PFAM
Pfam:AlaDh_PNT_C 161 242 6e-8 PFAM
Pfam:ADH_zinc_N 183 313 3.1e-25 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sorbitol dehydrogenase (SORD; EC 1.1.1.14) catalyzes the interconversion of polyols and their corresponding ketoses, and together with aldose reductase (ALDR1; MIM 103880), makes up the sorbitol pathway that is believed to play an important role in the development of diabetic complications (summarized by Carr and Markham, 1995 [PubMed 8535074]). The first reaction of the pathway (also called the polyol pathway) is the reduction of glucose to sorbitol by ALDR1 with NADPH as the cofactor. SORD then oxidizes the sorbitol to fructose using NAD(+) cofactor.[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for a functional null allele found in strain C57BL/LiA exhibit no obvious abnormalities in the kidney or other physiological systems. An additional isoelectric focusing variant is found in Peru stocks and has about 25% of the activity of that in most inbred strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Sord
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Sord APN 2 122264083 missense probably benign 0.28
R6015:Sord UTSW 2 122256943 missense probably damaging 1.00
R6258:Sord UTSW 2 122259132 critical splice donor site probably null
R6260:Sord UTSW 2 122259132 critical splice donor site probably null
R6420:Sord UTSW 2 122264121 missense possibly damaging 0.93
R6940:Sord UTSW 2 122264055 missense probably damaging 0.99
R7800:Sord UTSW 2 122259080 missense probably damaging 0.97
R7903:Sord UTSW 2 122263225 missense probably benign 0.02
R7986:Sord UTSW 2 122263225 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCATACCCTCAGACTGCAG -3'
(R):5'- AAGTTCTGCATTTACGGCCTC -3'

Sequencing Primer
(F):5'- AAGGCTCCTGTCAGAAGCACTG -3'
(R):5'- GGCCTCCCCTTCTAGCCATTTAG -3'
Posted On2018-05-24