Incidental Mutation 'R6417:Tnrc6a'
ID518115
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Nametrinucleotide repeat containing 6a
SynonymsCAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik
MMRRC Submission
Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location123123885-123195296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123171074 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 696 (T696A)
Ref Sequence ENSEMBL: ENSMUSP00000091595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014] [ENSMUST00000206888]
Predicted Effect probably benign
Transcript: ENSMUST00000094053
AA Change: T696A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: T696A

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205449
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205732
Predicted Effect unknown
Transcript: ENSMUST00000205760
AA Change: T148A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205789
Predicted Effect probably benign
Transcript: ENSMUST00000206014
Predicted Effect probably benign
Transcript: ENSMUST00000206888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211170
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 123170780 missense probably benign 0.04
IGL00580:Tnrc6a APN 7 123174278 missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 123171494 missense probably benign 0.04
IGL02004:Tnrc6a APN 7 123181366 missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 123152191 intron probably benign
IGL02220:Tnrc6a APN 7 123170456 missense probably benign
IGL02436:Tnrc6a APN 7 123184215 nonsense probably null
IGL02670:Tnrc6a APN 7 123171312 missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 123171473 missense probably damaging 1.00
0152:Tnrc6a UTSW 7 123180654 missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0369:Tnrc6a UTSW 7 123170860 missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 123186728 splice site probably benign
R0566:Tnrc6a UTSW 7 123170913 missense probably benign 0.00
R0600:Tnrc6a UTSW 7 123171816 missense probably benign 0.14
R0751:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 123184251 missense probably benign 0.02
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 123176875 missense probably benign 0.08
R1709:Tnrc6a UTSW 7 123169982 missense probably benign 0.10
R1776:Tnrc6a UTSW 7 123171297 missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 123192917 missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 123162446 splice site probably benign
R1876:Tnrc6a UTSW 7 123162446 splice site probably benign
R2010:Tnrc6a UTSW 7 123171046 missense probably benign 0.26
R2086:Tnrc6a UTSW 7 123162446 splice site probably benign
R2089:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2511:Tnrc6a UTSW 7 123171092 missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 123192949 makesense probably null
R2850:Tnrc6a UTSW 7 123179800 missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 123181384 missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 123170121 missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 123171680 missense probably benign 0.00
R4439:Tnrc6a UTSW 7 123152182 nonsense probably null
R4525:Tnrc6a UTSW 7 123179782 missense probably benign
R4578:Tnrc6a UTSW 7 123184221 missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 123184289 critical splice donor site probably null
R4711:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 123192090 missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 123189997 missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 123169911 missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 123192613 missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 123189872 missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 123186723 critical splice donor site probably null
R5239:Tnrc6a UTSW 7 123186619 missense probably benign
R5604:Tnrc6a UTSW 7 123174236 missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 123170076 missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 123186665 missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 123182380 missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 123143742 splice site probably null
R6284:Tnrc6a UTSW 7 123171335 missense probably damaging 0.99
R6420:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6575:Tnrc6a UTSW 7 123169910 missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 123171999 missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 123187445 missense probably benign 0.17
R6968:Tnrc6a UTSW 7 123182427 missense probably benign 0.05
R7216:Tnrc6a UTSW 7 123171495 missense probably benign 0.01
R7260:Tnrc6a UTSW 7 123186590 missense probably benign 0.36
R7299:Tnrc6a UTSW 7 123170913 missense probably benign
R7322:Tnrc6a UTSW 7 123171508 missense probably benign 0.09
R7500:Tnrc6a UTSW 7 123173450 intron probably null
R7872:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
R7955:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
R8270:Tnrc6a UTSW 7 123170071 missense possibly damaging 0.92
R8313:Tnrc6a UTSW 7 123170713 missense possibly damaging 0.92
X0064:Tnrc6a UTSW 7 123169798 missense probably benign 0.28
Z1176:Tnrc6a UTSW 7 123162496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGACGATCAGGGTTCTGC -3'
(R):5'- CCACCCTGATACAGATGAGGTATC -3'

Sequencing Primer
(F):5'- AGGGTTCTGCCACATCTCAGAC -3'
(R):5'- AGGGCTAGTCTTATCTGTACATGCC -3'
Posted On2018-05-24