Incidental Mutation 'R6417:Urb2'
ID518117
Institutional Source Beutler Lab
Gene Symbol Urb2
Ensembl Gene ENSMUSG00000031976
Gene NameURB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124021508-124048505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124047199 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1490 (R1490W)
Ref Sequence ENSEMBL: ENSMUSP00000034457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034457] [ENSMUST00000127664] [ENSMUST00000173168]
Predicted Effect probably damaging
Transcript: ENSMUST00000034457
AA Change: R1490W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034457
Gene: ENSMUSG00000031976
AA Change: R1490W

DomainStartEndE-ValueType
low complexity region 489 503 N/A INTRINSIC
low complexity region 541 546 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
low complexity region 1073 1092 N/A INTRINSIC
low complexity region 1172 1188 N/A INTRINSIC
low complexity region 1273 1279 N/A INTRINSIC
Pfam:Urb2 1319 1515 2.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173168
SMART Domains Protein: ENSMUSP00000133547
Gene: ENSMUSG00000031976

DomainStartEndE-ValueType
low complexity region 489 503 N/A INTRINSIC
low complexity region 541 546 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
low complexity region 1073 1092 N/A INTRINSIC
low complexity region 1172 1188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212460
Meta Mutation Damage Score 0.3115 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Urb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Urb2 APN 8 124028694 missense probably damaging 1.00
IGL00705:Urb2 APN 8 124036637 missense probably benign 0.00
IGL02090:Urb2 APN 8 124028237 missense probably benign 0.28
IGL02707:Urb2 APN 8 124030686 missense probably benign 0.04
IGL03103:Urb2 APN 8 124029752 missense probably benign 0.17
IGL03402:Urb2 APN 8 124029849 missense possibly damaging 0.92
R0037:Urb2 UTSW 8 124047195 missense probably damaging 1.00
R0113:Urb2 UTSW 8 124030926 missense probably benign 0.00
R0883:Urb2 UTSW 8 124030970 nonsense probably null
R1015:Urb2 UTSW 8 124029434 missense probably damaging 1.00
R1265:Urb2 UTSW 8 124025153 missense probably damaging 1.00
R1463:Urb2 UTSW 8 124030908 missense probably benign 0.04
R1497:Urb2 UTSW 8 124028077 missense probably damaging 1.00
R1556:Urb2 UTSW 8 124030617 missense probably damaging 1.00
R1622:Urb2 UTSW 8 124029624 missense probably benign
R1914:Urb2 UTSW 8 124029798 missense possibly damaging 0.81
R1915:Urb2 UTSW 8 124029798 missense possibly damaging 0.81
R2172:Urb2 UTSW 8 124031102 missense probably damaging 1.00
R2240:Urb2 UTSW 8 124030139 missense probably benign 0.02
R2424:Urb2 UTSW 8 124030426 missense probably benign 0.02
R4085:Urb2 UTSW 8 124030941 missense probably benign 0.02
R4119:Urb2 UTSW 8 124047240 missense probably benign 0.00
R4732:Urb2 UTSW 8 124028897 missense probably damaging 1.00
R4733:Urb2 UTSW 8 124028897 missense probably damaging 1.00
R4865:Urb2 UTSW 8 124029635 nonsense probably null
R5005:Urb2 UTSW 8 124031181 missense probably damaging 0.97
R5381:Urb2 UTSW 8 124029912 missense probably benign 0.02
R5704:Urb2 UTSW 8 124038182 missense probably damaging 0.97
R5891:Urb2 UTSW 8 124030856 missense possibly damaging 0.64
R5958:Urb2 UTSW 8 124029659 missense probably benign 0.01
R5966:Urb2 UTSW 8 124028088 missense probably benign 0.00
R6133:Urb2 UTSW 8 124028561 nonsense probably null
R6136:Urb2 UTSW 8 124030092 missense probably benign
R6341:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6343:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6344:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6420:Urb2 UTSW 8 124047199 missense probably damaging 1.00
R6585:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6586:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6587:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6588:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R7061:Urb2 UTSW 8 124028297 missense probably benign
R7090:Urb2 UTSW 8 124030599 missense probably benign
R7371:Urb2 UTSW 8 124028269 missense probably benign 0.00
R7467:Urb2 UTSW 8 124028511 missense probably benign
R7542:Urb2 UTSW 8 124028588 missense probably benign
R7545:Urb2 UTSW 8 124029752 missense probably benign 0.00
R7686:Urb2 UTSW 8 124045172 missense probably benign 0.01
R8046:Urb2 UTSW 8 124028032 missense possibly damaging 0.92
R8101:Urb2 UTSW 8 124028040 missense probably benign 0.01
X0020:Urb2 UTSW 8 124030983 missense possibly damaging 0.91
X0027:Urb2 UTSW 8 124028814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCGAGTCTCAAGGCCAG -3'
(R):5'- TATGAGAACGTCAGAAGCCTTAC -3'

Sequencing Primer
(F):5'- AGTCTCAAGGCCAGGGTTCTG -3'
(R):5'- GTCAGAAGCCTTACATCCTCCAGG -3'
Posted On2018-05-24