Incidental Mutation 'R6417:Olfr890'
ID518119
Institutional Source Beutler Lab
Gene Symbol Olfr890
Ensembl Gene ENSMUSG00000096409
Gene Nameolfactory receptor 890
SynonymsMOR162-3, MOR162-15_p, GA_x6K02T2PVTD-31822365-31823309
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38142517-38148375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 38143315 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 55 (L55R)
Ref Sequence ENSEMBL: ENSMUSP00000149829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079804] [ENSMUST00000213458]
Predicted Effect probably damaging
Transcript: ENSMUST00000079804
AA Change: L60R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078733
Gene: ENSMUSG00000096409
AA Change: L60R

DomainStartEndE-ValueType
Pfam:7tm_4 36 311 2.3e-48 PFAM
Pfam:7tm_1 46 293 9.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213458
AA Change: L55R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Olfr890
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Olfr890 APN 9 38143871 nonsense probably null
IGL01861:Olfr890 APN 9 38143750 missense probably damaging 1.00
IGL02174:Olfr890 APN 9 38143785 missense possibly damaging 0.90
IGL02723:Olfr890 APN 9 38143411 missense probably benign 0.02
IGL03085:Olfr890 APN 9 38143183 missense probably damaging 0.98
FR4449:Olfr890 UTSW 9 38143188 missense probably benign 0.00
FR4737:Olfr890 UTSW 9 38143188 missense probably benign 0.00
R0637:Olfr890 UTSW 9 38143882 missense probably benign 0.00
R1353:Olfr890 UTSW 9 38143728 missense probably benign 0.03
R1813:Olfr890 UTSW 9 38143729 missense possibly damaging 0.78
R5997:Olfr890 UTSW 9 38143801 missense probably damaging 1.00
R6004:Olfr890 UTSW 9 38143960 missense probably damaging 1.00
R6420:Olfr890 UTSW 9 38143315 missense probably damaging 1.00
R6720:Olfr890 UTSW 9 38143153 start codon destroyed probably null 1.00
R7223:Olfr890 UTSW 9 38143753 missense probably benign 0.02
R7601:Olfr890 UTSW 9 38143378 missense probably benign 0.13
R7671:Olfr890 UTSW 9 38143440 missense probably benign 0.02
R8034:Olfr890 UTSW 9 38143677 missense probably damaging 1.00
Z1176:Olfr890 UTSW 9 38143431 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATGACATTGGAAAGAATGGCC -3'
(R):5'- AGGGGCTTACAGATTGCAGC -3'

Sequencing Primer
(F):5'- CTTCAGCAATGACTCTTCTGTGAAGG -3'
(R):5'- GATTGCAGCATATCTGTCATAGGCC -3'
Posted On2018-05-24