Incidental Mutation 'R6417:Plk5'
ID518120
Institutional Source Beutler Lab
Gene Symbol Plk5
Ensembl Gene ENSMUSG00000035486
Gene Namepolo like kinase 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6417 (G1)
Quality Score194.009
Status Validated
Chromosome10
Chromosomal Location80356459-80365489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80364072 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 471 (V471A)
Ref Sequence ENSEMBL: ENSMUSP00000100988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039836] [ENSMUST00000105351]
Predicted Effect probably benign
Transcript: ENSMUST00000039836
AA Change: V475A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044400
Gene: ENSMUSG00000035486
AA Change: V475A

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
S_TKc 27 283 2.41e-90 SMART
Pfam:POLO_box 425 486 4.9e-18 PFAM
low complexity region 583 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105351
AA Change: V471A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000100988
Gene: ENSMUSG00000035486
AA Change: V471A

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
S_TKc 27 279 2.56e-94 SMART
Pfam:POLO_box 420 483 1.6e-17 PFAM
low complexity region 579 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152544
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Plk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Plk5 APN 10 80363167 critical splice donor site probably null
IGL02605:Plk5 APN 10 80363062 missense probably damaging 0.99
R0083:Plk5 UTSW 10 80356662 missense possibly damaging 0.91
R0590:Plk5 UTSW 10 80360223 missense probably damaging 1.00
R0783:Plk5 UTSW 10 80361130 missense probably benign
R1815:Plk5 UTSW 10 80364021 missense probably benign 0.03
R1866:Plk5 UTSW 10 80360569 splice site probably null
R1991:Plk5 UTSW 10 80363102 missense possibly damaging 0.53
R4501:Plk5 UTSW 10 80359471 missense probably benign 0.05
R4580:Plk5 UTSW 10 80360467 missense possibly damaging 0.95
R4731:Plk5 UTSW 10 80358797 missense probably damaging 1.00
R4801:Plk5 UTSW 10 80359304 missense possibly damaging 0.87
R4802:Plk5 UTSW 10 80359304 missense possibly damaging 0.87
R5084:Plk5 UTSW 10 80358889 missense possibly damaging 0.75
R5346:Plk5 UTSW 10 80363108 missense probably damaging 1.00
R5702:Plk5 UTSW 10 80360567 critical splice donor site probably null
R6548:Plk5 UTSW 10 80363045 missense probably damaging 1.00
R6695:Plk5 UTSW 10 80360201 missense probably benign 0.22
X0019:Plk5 UTSW 10 80364301 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCTTAGTAAATCCTCCACC -3'
(R):5'- GTCAGCAATGAAGCTCAGCAG -3'

Sequencing Primer
(F):5'- AGTGGCCGTTTCCATGGAGAC -3'
(R):5'- TGAAGCTCAGCAGAGAGATGTC -3'
Posted On2018-05-24