Incidental Mutation 'R6417:Srp54b'
ID518122
Institutional Source Beutler Lab
Gene Symbol Srp54b
Ensembl Gene ENSMUSG00000112449
Gene Namesignal recognition particle 54B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location55155104-55189573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55250070 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 184 (F184L)
Ref Sequence ENSEMBL: ENSMUSP00000151681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164243] [ENSMUST00000218879]
Predicted Effect probably damaging
Transcript: ENSMUST00000164243
AA Change: F184L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132835
Gene: ENSMUSG00000079108
AA Change: F184L

DomainStartEndE-ValueType
SRP54_N 2 87 7.47e-19 SMART
AAA 100 277 2.15e-7 SMART
SRP54 101 296 7.25e-90 SMART
Pfam:SRP_SPB 326 431 9.2e-33 PFAM
low complexity region 490 504 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218879
AA Change: F184L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Srp54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Srp54b APN 12 55252775 missense probably benign 0.39
R0101:Srp54b UTSW 12 55255620 splice site probably benign
R0395:Srp54b UTSW 12 55250099 missense probably damaging 1.00
R1076:Srp54b UTSW 12 55255528 splice site probably benign
R1186:Srp54b UTSW 12 55255528 splice site probably benign
R1520:Srp54b UTSW 12 55257569 missense possibly damaging 0.68
R1541:Srp54b UTSW 12 55256059 missense probably benign 0.27
R1732:Srp54b UTSW 12 55252759 splice site probably null
R1836:Srp54b UTSW 12 55250160 splice site probably null
R5344:Srp54b UTSW 12 55255581 missense probably damaging 1.00
R5841:Srp54b UTSW 12 55252829 missense probably benign 0.01
R6269:Srp54b UTSW 12 55255972 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATGCCAAAGAAATGGGCTTC -3'
(R):5'- CAGTGATAGTAGCTGTCTTACAGG -3'

Sequencing Primer
(F):5'- AGAAATGGGCTTCTGTATTTATTACG -3'
(R):5'- GTCCCATGGAAAGCTACT -3'
Posted On2018-05-24