Incidental Mutation 'R6417:Tcte1'
ID518129
Institutional Source Beutler Lab
Gene Symbol Tcte1
Ensembl Gene ENSMUSG00000023949
Gene Namet-complex-associated testis expressed 1
SynonymsTcte-1, D17Sil1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location45523434-45542679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45535130 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 220 (E220G)
Ref Sequence ENSEMBL: ENSMUSP00000109175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113547]
Predicted Effect probably damaging
Transcript: ENSMUST00000113547
AA Change: E220G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109175
Gene: ENSMUSG00000023949
AA Change: E220G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
Blast:LRR 235 274 7e-14 BLAST
LRR 304 331 5.02e-6 SMART
LRR 332 358 1.28e-3 SMART
LRR 359 386 5.81e-2 SMART
LRR 387 414 2.05e-2 SMART
LRR 415 442 1.13e-4 SMART
Blast:LRR 443 470 3e-8 BLAST
Meta Mutation Damage Score 0.1023 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Tcte1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tcte1 APN 17 45534928 missense probably damaging 1.00
IGL00945:Tcte1 APN 17 45541189 missense probably benign 0.15
IGL01120:Tcte1 APN 17 45539668 missense probably damaging 0.99
IGL01132:Tcte1 APN 17 45539862 missense possibly damaging 0.93
IGL01884:Tcte1 APN 17 45539809 unclassified probably null
IGL02418:Tcte1 APN 17 45541202 missense probably benign 0.37
IGL02731:Tcte1 APN 17 45539886 missense probably benign 0.00
IGL03130:Tcte1 APN 17 45533296 missense probably damaging 1.00
R0358:Tcte1 UTSW 17 45535285 missense probably benign 0.34
R1519:Tcte1 UTSW 17 45535252 missense probably damaging 1.00
R2013:Tcte1 UTSW 17 45541311 missense probably benign 0.30
R2014:Tcte1 UTSW 17 45541311 missense probably benign 0.30
R3744:Tcte1 UTSW 17 45539671 missense probably damaging 0.99
R4250:Tcte1 UTSW 17 45539691 missense probably benign 0.04
R4976:Tcte1 UTSW 17 45534928 missense probably damaging 1.00
R5398:Tcte1 UTSW 17 45539826 nonsense probably null
R6169:Tcte1 UTSW 17 45535070 missense probably benign 0.01
R6251:Tcte1 UTSW 17 45535159 missense probably benign
R6279:Tcte1 UTSW 17 45533289 missense possibly damaging 0.69
R6300:Tcte1 UTSW 17 45533289 missense possibly damaging 0.69
R6316:Tcte1 UTSW 17 45534860 missense probably benign
R6892:Tcte1 UTSW 17 45533157 missense probably benign
R7047:Tcte1 UTSW 17 45533368 missense possibly damaging 0.52
R7645:Tcte1 UTSW 17 45534989 missense probably benign 0.00
R8125:Tcte1 UTSW 17 45539692 missense possibly damaging 0.88
Z1176:Tcte1 UTSW 17 45535071 missense probably benign
Z1177:Tcte1 UTSW 17 45535012 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGAATTACTGGCACCGCTG -3'
(R):5'- CAAGCTTTGATGGTGGCTGC -3'

Sequencing Primer
(F):5'- CTGGAGAACCTGCTGAAGCTATTC -3'
(R):5'- TGCCAGAGAGTAGCAGTCTC -3'
Posted On2018-05-24