Incidental Mutation 'R6417:Zfp959'
ID518130
Institutional Source Beutler Lab
Gene Symbol Zfp959
Ensembl Gene ENSMUSG00000003198
Gene Namezinc finger protein 959
SynonymsBC011426
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location55892093-55898928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55898094 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 377 (G377D)
Ref Sequence ENSEMBL: ENSMUSP00000053979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054780] [ENSMUST00000224379]
Predicted Effect probably damaging
Transcript: ENSMUST00000054780
AA Change: G377D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053979
Gene: ENSMUSG00000003198
AA Change: G377D

DomainStartEndE-ValueType
KRAB 4 66 5.28e-14 SMART
ZnF_C2H2 155 177 2.57e2 SMART
ZnF_C2H2 287 309 1.1e-2 SMART
ZnF_C2H2 315 337 4.17e-3 SMART
ZnF_C2H2 343 365 1.47e-3 SMART
ZnF_C2H2 371 393 5.14e-3 SMART
ZnF_C2H2 399 421 1.82e-3 SMART
ZnF_C2H2 427 449 1.98e-4 SMART
ZnF_C2H2 455 477 2.57e-3 SMART
ZnF_C2H2 483 505 7.26e-3 SMART
ZnF_C2H2 511 533 1.72e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224294
Predicted Effect probably benign
Transcript: ENSMUST00000224379
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Zfp959
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfp959 APN 17 55897565 missense possibly damaging 0.91
IGL02731:Zfp959 APN 17 55895956 splice site probably benign
IGL03206:Zfp959 APN 17 55897613 missense possibly damaging 0.78
R0141:Zfp959 UTSW 17 55898139 missense probably benign 0.41
R0347:Zfp959 UTSW 17 55897180 nonsense probably null
R0522:Zfp959 UTSW 17 55896201 missense probably null 1.00
R1692:Zfp959 UTSW 17 55898299 missense probably damaging 0.99
R1771:Zfp959 UTSW 17 55897677 unclassified probably null
R1891:Zfp959 UTSW 17 55897604 missense probably damaging 1.00
R1945:Zfp959 UTSW 17 55897231 nonsense probably null
R1959:Zfp959 UTSW 17 55897404 missense probably damaging 0.98
R2317:Zfp959 UTSW 17 55897326 missense possibly damaging 0.59
R4726:Zfp959 UTSW 17 55898260 unclassified probably null
R4869:Zfp959 UTSW 17 55897228 missense possibly damaging 0.95
R5436:Zfp959 UTSW 17 55897626 missense probably benign
R6235:Zfp959 UTSW 17 55897427 missense probably damaging 1.00
R6365:Zfp959 UTSW 17 55897785 missense probably damaging 1.00
R6391:Zfp959 UTSW 17 55895854 missense probably damaging 1.00
R6420:Zfp959 UTSW 17 55898094 missense probably damaging 1.00
R7114:Zfp959 UTSW 17 55898501 missense possibly damaging 0.94
R7380:Zfp959 UTSW 17 55898551 missense possibly damaging 0.94
R7437:Zfp959 UTSW 17 55898334 missense probably damaging 1.00
R7568:Zfp959 UTSW 17 55897886 missense probably benign 0.01
R8114:Zfp959 UTSW 17 55898496 missense probably benign 0.09
Z1088:Zfp959 UTSW 17 55898135 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATCAGAATTGTAATCAAGTAGGTAG -3'
(R):5'- TCATTTCTTAGATGGCTAGGGGA -3'

Sequencing Primer
(F):5'- ATGGGGTAAAGCCTTCACATGTCC -3'
(R):5'- CGATCAAAGGGTTTACCACATTGG -3'
Posted On2018-05-24