Incidental Mutation 'R6417:Slc25a23'
ID518131
Institutional Source Beutler Lab
Gene Symbol Slc25a23
Ensembl Gene ENSMUSG00000046329
Gene Namesolute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57043711-57059863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57052780 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 324 (I324V)
Ref Sequence ENSEMBL: ENSMUSP00000040198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040280] [ENSMUST00000171528]
Predicted Effect probably damaging
Transcript: ENSMUST00000040280
AA Change: I324V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040198
Gene: ENSMUSG00000046329
AA Change: I324V

DomainStartEndE-ValueType
EFh 13 41 2.72e-3 SMART
EFh 80 108 1.09e0 SMART
EFh 116 144 3.07e1 SMART
Pfam:Mito_carr 181 273 3.8e-25 PFAM
Pfam:Mito_carr 274 366 4.1e-26 PFAM
Pfam:Mito_carr 372 465 6.5e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000163442
AA Change: I15V
SMART Domains Protein: ENSMUSP00000132962
Gene: ENSMUSG00000046329
AA Change: I15V

DomainStartEndE-ValueType
Pfam:Mito_carr 1 58 6.5e-15 PFAM
Pfam:Mito_carr 64 123 1.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165187
Predicted Effect unknown
Transcript: ENSMUST00000170015
AA Change: I123V
SMART Domains Protein: ENSMUSP00000132169
Gene: ENSMUSG00000046329
AA Change: I123V

DomainStartEndE-ValueType
Pfam:Mito_carr 1 76 1.9e-19 PFAM
Pfam:Mito_carr 77 166 1.2e-21 PFAM
Pfam:Mito_carr 172 265 7.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171128
Predicted Effect probably benign
Transcript: ENSMUST00000171528
AA Change: I72V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128348
Gene: ENSMUSG00000046329
AA Change: I72V

DomainStartEndE-ValueType
Pfam:Mito_carr 22 114 8.3e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired mitochondrial function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Slc25a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Slc25a23 APN 17 57047233 missense probably benign 0.01
IGL01614:Slc25a23 APN 17 57045579 missense probably null 0.98
IGL01919:Slc25a23 APN 17 57047291 missense possibly damaging 0.61
IGL01933:Slc25a23 APN 17 57052813 nonsense probably null
IGL02297:Slc25a23 APN 17 57053324 missense probably benign 0.00
R1317:Slc25a23 UTSW 17 57053888 missense possibly damaging 0.63
R1411:Slc25a23 UTSW 17 57059622 missense probably damaging 0.97
R1577:Slc25a23 UTSW 17 57047306 missense probably benign 0.00
R2156:Slc25a23 UTSW 17 57045562 missense probably benign 0.00
R4581:Slc25a23 UTSW 17 57052740 missense probably damaging 0.96
R4755:Slc25a23 UTSW 17 57052794 missense possibly damaging 0.92
R4786:Slc25a23 UTSW 17 57047326 missense possibly damaging 0.68
R4789:Slc25a23 UTSW 17 57059597 missense probably damaging 1.00
R5402:Slc25a23 UTSW 17 57053336 missense probably benign 0.07
R5423:Slc25a23 UTSW 17 57053597 missense probably damaging 0.99
R5478:Slc25a23 UTSW 17 57052780 missense probably damaging 1.00
R5659:Slc25a23 UTSW 17 57045500 unclassified probably benign
R5787:Slc25a23 UTSW 17 57053825 missense probably damaging 1.00
R6420:Slc25a23 UTSW 17 57052780 missense probably damaging 0.98
R6462:Slc25a23 UTSW 17 57052720 missense probably damaging 1.00
R6830:Slc25a23 UTSW 17 57053804 nonsense probably null
R6858:Slc25a23 UTSW 17 57058171 missense probably damaging 1.00
R7311:Slc25a23 UTSW 17 57052827 missense probably damaging 1.00
R7381:Slc25a23 UTSW 17 57053587 missense probably damaging 1.00
R7491:Slc25a23 UTSW 17 57052822 nonsense probably null
R7543:Slc25a23 UTSW 17 57058106 critical splice donor site probably null
R7646:Slc25a23 UTSW 17 57059759 unclassified probably benign
X0026:Slc25a23 UTSW 17 57055350 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCTGATATTTGGAGGGTCTTCC -3'
(R):5'- ACATCTGCTTTCAGGAGTAGC -3'

Sequencing Primer
(F):5'- GGGTTCCAAGACCCAACATAGTTTTC -3'
(R):5'- AGTAGCCACTTCTAGGTGATGTCAC -3'
Posted On2018-05-24