Incidental Mutation 'R6417:Olfr1425'
ID518133
Institutional Source Beutler Lab
Gene Symbol Olfr1425
Ensembl Gene ENSMUSG00000067526
Gene Nameolfactory receptor 1425
SynonymsGA_x6K02T2RE5P-2433425-2432490, MOR239-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12073234-12077731 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 12073960 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 224 (K224T)
Ref Sequence ENSEMBL: ENSMUSP00000151154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087828] [ENSMUST00000214918]
Predicted Effect probably benign
Transcript: ENSMUST00000087828
AA Change: K225T

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085130
Gene: ENSMUSG00000067526
AA Change: K225T

DomainStartEndE-ValueType
Pfam:7tm_4 30 303 9.3e-48 PFAM
Pfam:7tm_1 40 286 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214918
AA Change: K224T

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Olfr1425
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Olfr1425 APN 19 12074057 missense probably benign 0.00
IGL02508:Olfr1425 APN 19 12073887 missense possibly damaging 0.90
IGL03183:Olfr1425 APN 19 12074028 missense probably damaging 0.98
R1164:Olfr1425 UTSW 19 12074241 nonsense probably null
R1866:Olfr1425 UTSW 19 12073819 missense probably benign 0.03
R3745:Olfr1425 UTSW 19 12074380 missense probably damaging 1.00
R4364:Olfr1425 UTSW 19 12074497 missense probably benign 0.13
R4888:Olfr1425 UTSW 19 12074315 missense probably damaging 1.00
R4962:Olfr1425 UTSW 19 12074275 missense probably damaging 1.00
R5954:Olfr1425 UTSW 19 12074083 missense possibly damaging 0.96
R6383:Olfr1425 UTSW 19 12074363 missense probably damaging 1.00
R6409:Olfr1425 UTSW 19 12074747 start gained probably benign
R6420:Olfr1425 UTSW 19 12073960 missense probably benign 0.18
R7109:Olfr1425 UTSW 19 12074212 missense probably benign
R7446:Olfr1425 UTSW 19 12073697 makesense probably null
R7505:Olfr1425 UTSW 19 12074605 missense possibly damaging 0.88
Z1176:Olfr1425 UTSW 19 12073840 missense probably damaging 1.00
Z1176:Olfr1425 UTSW 19 12073910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTCTCCTCATGGCTGAC -3'
(R):5'- TCTGTGGACCCAATGTTCTTG -3'

Sequencing Primer
(F):5'- CCTGGTTCCTTAGAGTGTAGATCAAG -3'
(R):5'- GTGGACCCAATGTTCTTGATACTTTC -3'
Posted On2018-05-24