Incidental Mutation 'R6420:Zfp846'
ID 518153
Institutional Source Beutler Lab
Gene Symbol Zfp846
Ensembl Gene ENSMUSG00000058192
Gene Name zinc finger protein 846
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R6420 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 20581291-20605409 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20593711 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 289 (L289P)
Ref Sequence ENSEMBL: ENSMUSP00000111219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060063] [ENSMUST00000115557] [ENSMUST00000140668]
AlphaFold G3X996
Predicted Effect probably damaging
Transcript: ENSMUST00000060063
AA Change: L289P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051593
Gene: ENSMUSG00000058192
AA Change: L289P

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115557
AA Change: L289P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111219
Gene: ENSMUSG00000058192
AA Change: L289P

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140668
SMART Domains Protein: ENSMUSP00000115945
Gene: ENSMUSG00000058192

DomainStartEndE-ValueType
KRAB 14 67 1.99e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217655
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,398 I117N probably damaging Het
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Dhx16 A G 17: 35,883,014 E367G possibly damaging Het
Epc2 T C 2: 49,451,900 V32A probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hdlbp T C 1: 93,431,004 E275G probably damaging Het
Kdm7a T C 6: 39,165,168 D392G probably damaging Het
Lgmn T A 12: 102,423,719 R4* probably null Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Mup1 C G 4: 60,501,759 E31Q possibly damaging Het
Nckap1l G C 15: 103,491,466 G1025A possibly damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pik3r5 G A 11: 68,475,424 W42* probably null Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Rad1 T C 15: 10,488,012 V74A probably benign Het
Scara3 C T 14: 65,938,252 G22D possibly damaging Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Sema5b T A 16: 35,663,146 D1051E probably benign Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Spag9 T C 11: 94,086,302 V78A probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Zfp62 A T 11: 49,216,513 N477I probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Zfp846
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Zfp846 APN 9 20588609 missense probably damaging 1.00
IGL02440:Zfp846 APN 9 20588500 splice site probably benign
R0077:Zfp846 UTSW 9 20594007 missense probably benign 0.00
R0528:Zfp846 UTSW 9 20587928 splice site probably benign
R0675:Zfp846 UTSW 9 20593557 missense probably benign
R1116:Zfp846 UTSW 9 20593263 missense possibly damaging 0.96
R1439:Zfp846 UTSW 9 20594097 missense possibly damaging 0.83
R3803:Zfp846 UTSW 9 20594439 missense probably benign
R4586:Zfp846 UTSW 9 20593513 missense probably damaging 0.96
R4872:Zfp846 UTSW 9 20590815 missense probably benign
R6221:Zfp846 UTSW 9 20593295 missense possibly damaging 0.53
R6416:Zfp846 UTSW 9 20593720 missense possibly damaging 0.93
R6526:Zfp846 UTSW 9 20593871 missense probably benign 0.23
R7003:Zfp846 UTSW 9 20587892 start codon destroyed probably null 0.99
R7332:Zfp846 UTSW 9 20594225 missense probably benign 0.00
R7651:Zfp846 UTSW 9 20588512 missense possibly damaging 0.86
R8254:Zfp846 UTSW 9 20593291 missense probably benign
R8724:Zfp846 UTSW 9 20594056 missense possibly damaging 0.88
R8997:Zfp846 UTSW 9 20594430 missense probably benign 0.41
R9045:Zfp846 UTSW 9 20593893 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTTCAAATCTCAATAGACACCTGC -3'
(R):5'- AGGCATCTCTCCACTGTGTG -3'

Sequencing Primer
(F):5'- TGTGGGAAAGCCTTCACTAC -3'
(R):5'- CTCCACTGTGTGTTTTTCTTATATGG -3'
Posted On 2018-05-24