Incidental Mutation 'R6420:Zfp846'
ID518153
Institutional Source Beutler Lab
Gene Symbol Zfp846
Ensembl Gene ENSMUSG00000058192
Gene Namezinc finger protein 846
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6420 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20581291-20605409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20593711 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 289 (L289P)
Ref Sequence ENSEMBL: ENSMUSP00000111219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060063] [ENSMUST00000115557] [ENSMUST00000140668]
Predicted Effect probably damaging
Transcript: ENSMUST00000060063
AA Change: L289P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051593
Gene: ENSMUSG00000058192
AA Change: L289P

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115557
AA Change: L289P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111219
Gene: ENSMUSG00000058192
AA Change: L289P

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140668
SMART Domains Protein: ENSMUSP00000115945
Gene: ENSMUSG00000058192

DomainStartEndE-ValueType
KRAB 14 67 1.99e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217655
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,398 I117N probably damaging Het
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Dhx16 A G 17: 35,883,014 E367G possibly damaging Het
Epc2 T C 2: 49,451,900 V32A probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hdlbp T C 1: 93,431,004 E275G probably damaging Het
Kdm7a T C 6: 39,165,168 D392G probably damaging Het
Lgmn T A 12: 102,423,719 R4* probably null Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Mup1 C G 4: 60,501,759 E31Q possibly damaging Het
Nckap1l G C 15: 103,491,466 G1025A possibly damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pik3r5 G A 11: 68,475,424 W42* probably null Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Rad1 T C 15: 10,488,012 V74A probably benign Het
Scara3 C T 14: 65,938,252 G22D possibly damaging Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Sema5b T A 16: 35,663,146 D1051E probably benign Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Spag9 T C 11: 94,086,302 V78A probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Zfp62 A T 11: 49,216,513 N477I probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Zfp846
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Zfp846 APN 9 20588609 missense probably damaging 1.00
IGL02440:Zfp846 APN 9 20588500 splice site probably benign
R0077:Zfp846 UTSW 9 20594007 missense probably benign 0.00
R0528:Zfp846 UTSW 9 20587928 splice site probably benign
R0675:Zfp846 UTSW 9 20593557 missense probably benign
R1116:Zfp846 UTSW 9 20593263 missense possibly damaging 0.96
R1439:Zfp846 UTSW 9 20594097 missense possibly damaging 0.83
R3803:Zfp846 UTSW 9 20594439 missense probably benign
R4586:Zfp846 UTSW 9 20593513 missense probably damaging 0.96
R4872:Zfp846 UTSW 9 20590815 missense probably benign
R6221:Zfp846 UTSW 9 20593295 missense possibly damaging 0.53
R6416:Zfp846 UTSW 9 20593720 missense possibly damaging 0.93
R6526:Zfp846 UTSW 9 20593871 missense probably benign 0.23
R7003:Zfp846 UTSW 9 20587892 start codon destroyed probably null 0.99
R7332:Zfp846 UTSW 9 20594225 missense probably benign 0.00
R7651:Zfp846 UTSW 9 20588512 missense possibly damaging 0.86
R8254:Zfp846 UTSW 9 20593291 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCAAATCTCAATAGACACCTGC -3'
(R):5'- AGGCATCTCTCCACTGTGTG -3'

Sequencing Primer
(F):5'- TGTGGGAAAGCCTTCACTAC -3'
(R):5'- CTCCACTGTGTGTTTTTCTTATATGG -3'
Posted On2018-05-24