Incidental Mutation 'R6420:Spag9'
ID 518158
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Name sperm associated antigen 9
Synonyms JLP, Mapk8ip4, 3110018C07Rik, JIP4, 4733401I23Rik, syd1, 4831406C20Rik
MMRRC Submission 044562-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.737) question?
Stock # R6420 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 93886917-94016911 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93977128 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 78 (V78A)
Ref Sequence ENSEMBL: ENSMUSP00000117502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000132079] [ENSMUST00000153076]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000024979
AA Change: V358A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859
AA Change: V358A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 8e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041956
AA Change: V497A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: V497A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075695
AA Change: V358A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859
AA Change: V358A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 571 605 N/A INTRINSIC
low complexity region 734 750 N/A INTRINSIC
SCOP:d1kb0a2 822 968 3e-5 SMART
Blast:WD40 923 963 7e-18 BLAST
low complexity region 1131 1149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092777
AA Change: V359A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859
AA Change: V359A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 254 306 1e-25 PDB
low complexity region 307 340 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 7e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103168
AA Change: V354A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859
AA Change: V354A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 249 301 1e-25 PDB
low complexity region 302 335 N/A INTRINSIC
coiled coil region 567 601 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
SCOP:d1kb0a2 818 964 3e-5 SMART
Blast:WD40 919 959 8e-18 BLAST
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132079
SMART Domains Protein: ENSMUSP00000118850
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 360 394 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138154
Predicted Effect probably damaging
Transcript: ENSMUST00000153076
AA Change: V78A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859
AA Change: V78A

DomainStartEndE-ValueType
PDB:2W83|D 1 25 4e-8 PDB
low complexity region 26 59 N/A INTRINSIC
coiled coil region 291 325 N/A INTRINSIC
low complexity region 454 470 N/A INTRINSIC
SCOP:d1kb0a2 542 688 3e-5 SMART
Blast:WD40 643 683 1e-17 BLAST
low complexity region 864 882 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156019
AA Change: V346A
SMART Domains Protein: ENSMUSP00000115864
Gene: ENSMUSG00000020859
AA Change: V346A

DomainStartEndE-ValueType
Pfam:JIP_LZII 240 310 1.1e-32 PFAM
coiled coil region 559 593 N/A INTRINSIC
low complexity region 723 739 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,473,566 (GRCm39) I117N probably damaging Het
Abca15 A G 7: 119,996,351 (GRCm39) K1426E possibly damaging Het
Arhgef17 A G 7: 100,579,269 (GRCm39) S560P probably damaging Het
Asb13 G A 13: 3,693,574 (GRCm39) V111I probably damaging Het
Dhx16 A G 17: 36,193,906 (GRCm39) E367G possibly damaging Het
Epc2 T C 2: 49,341,912 (GRCm39) V32A probably damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Hdlbp T C 1: 93,358,726 (GRCm39) E275G probably damaging Het
Kdm7a T C 6: 39,142,102 (GRCm39) D392G probably damaging Het
Lgmn T A 12: 102,389,978 (GRCm39) R4* probably null Het
Lrrk2 C T 15: 91,696,549 (GRCm39) R2446C probably benign Het
Map3k10 A G 7: 27,362,709 (GRCm39) F459S probably damaging Het
Mup1 C G 4: 60,457,758 (GRCm39) E31Q possibly damaging Het
Nckap1l G C 15: 103,399,893 (GRCm39) G1025A possibly damaging Het
Or4d10 T G 19: 12,051,324 (GRCm39) K224T probably benign Het
Or5b24 A C 19: 12,912,584 (GRCm39) T161P probably damaging Het
Or8b39 T A 9: 37,996,890 (GRCm39) S253T probably benign Het
Or8b41 T G 9: 38,054,611 (GRCm39) L55R probably damaging Het
Or8k38 A T 2: 86,488,510 (GRCm39) C97* probably null Het
Pik3r5 G A 11: 68,366,250 (GRCm39) W42* probably null Het
Pkd1l2 C T 8: 117,740,638 (GRCm39) C2153Y probably damaging Het
Rad1 T C 15: 10,488,098 (GRCm39) V74A probably benign Het
Scara3 C T 14: 66,175,701 (GRCm39) G22D possibly damaging Het
Scn1a A G 2: 66,103,542 (GRCm39) I1906T probably damaging Het
Sema5b T A 16: 35,483,516 (GRCm39) D1051E probably benign Het
Slc16a12 T C 19: 34,650,097 (GRCm39) probably null Het
Slc25a23 T C 17: 57,359,780 (GRCm39) I324V probably damaging Het
Sord A T 2: 122,094,602 (GRCm39) K330M possibly damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Tnrc6a A G 7: 122,770,297 (GRCm39) T696A probably benign Het
Ttn A G 2: 76,542,619 (GRCm39) Y33456H possibly damaging Het
Unc45a C G 7: 79,989,400 (GRCm39) E23Q probably benign Het
Urb2 C T 8: 124,773,938 (GRCm39) R1490W probably damaging Het
Zfp62 A T 11: 49,107,340 (GRCm39) N477I probably damaging Het
Zfp846 T C 9: 20,505,007 (GRCm39) L289P probably damaging Het
Zfp959 G A 17: 56,205,094 (GRCm39) G377D probably damaging Het
Zswim3 G A 2: 164,662,653 (GRCm39) V378M probably damaging Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 93,988,692 (GRCm39) missense probably benign 0.02
IGL01776:Spag9 APN 11 94,007,553 (GRCm39) splice site probably benign
IGL02095:Spag9 APN 11 93,999,408 (GRCm39) missense probably damaging 1.00
IGL02307:Spag9 APN 11 93,992,986 (GRCm39) critical splice donor site probably null
IGL02417:Spag9 APN 11 94,007,567 (GRCm39) missense probably benign 0.27
IGL02480:Spag9 APN 11 93,999,413 (GRCm39) nonsense probably null
IGL02864:Spag9 APN 11 93,997,487 (GRCm39) missense probably damaging 1.00
IGL02976:Spag9 APN 11 93,974,779 (GRCm39) missense probably benign 0.30
IGL02979:Spag9 APN 11 93,988,190 (GRCm39) missense probably benign
IGL03349:Spag9 APN 11 93,984,335 (GRCm39) missense possibly damaging 0.51
dazzle UTSW 11 93,984,450 (GRCm39) nonsense probably null
R0128:Spag9 UTSW 11 93,984,365 (GRCm39) missense probably damaging 1.00
R0418:Spag9 UTSW 11 93,982,579 (GRCm39) splice site probably benign
R1463:Spag9 UTSW 11 94,007,663 (GRCm39) missense probably damaging 1.00
R1593:Spag9 UTSW 11 93,988,059 (GRCm39) missense probably damaging 1.00
R1605:Spag9 UTSW 11 93,939,365 (GRCm39) missense probably damaging 0.99
R1649:Spag9 UTSW 11 93,999,278 (GRCm39) splice site probably null
R1697:Spag9 UTSW 11 93,887,391 (GRCm39) missense probably benign 0.00
R1952:Spag9 UTSW 11 93,988,184 (GRCm39) missense possibly damaging 0.77
R2011:Spag9 UTSW 11 93,983,201 (GRCm39) nonsense probably null
R2012:Spag9 UTSW 11 93,983,201 (GRCm39) nonsense probably null
R2351:Spag9 UTSW 11 93,983,726 (GRCm39) missense probably damaging 1.00
R2367:Spag9 UTSW 11 94,007,583 (GRCm39) missense probably damaging 1.00
R3027:Spag9 UTSW 11 93,977,203 (GRCm39) missense probably null 1.00
R3766:Spag9 UTSW 11 93,951,109 (GRCm39) intron probably benign
R3777:Spag9 UTSW 11 93,989,852 (GRCm39) critical splice acceptor site probably null
R3937:Spag9 UTSW 11 93,935,305 (GRCm39) missense possibly damaging 0.92
R3937:Spag9 UTSW 11 93,935,243 (GRCm39) missense possibly damaging 0.94
R4417:Spag9 UTSW 11 93,951,172 (GRCm39) intron probably benign
R4445:Spag9 UTSW 11 93,988,079 (GRCm39) missense possibly damaging 0.95
R4711:Spag9 UTSW 11 94,005,177 (GRCm39) critical splice donor site probably null
R4799:Spag9 UTSW 11 93,939,343 (GRCm39) missense probably damaging 0.96
R4799:Spag9 UTSW 11 93,939,342 (GRCm39) missense possibly damaging 0.87
R4816:Spag9 UTSW 11 93,939,425 (GRCm39) intron probably benign
R4843:Spag9 UTSW 11 93,988,644 (GRCm39) missense probably damaging 1.00
R5020:Spag9 UTSW 11 93,988,612 (GRCm39) missense probably benign 0.08
R5119:Spag9 UTSW 11 94,013,548 (GRCm39) missense probably damaging 1.00
R5298:Spag9 UTSW 11 93,990,961 (GRCm39) missense probably damaging 1.00
R5304:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5305:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5395:Spag9 UTSW 11 93,982,577 (GRCm39) splice site probably null
R5636:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5638:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5654:Spag9 UTSW 11 93,981,538 (GRCm39) missense probably damaging 1.00
R5779:Spag9 UTSW 11 94,005,079 (GRCm39) missense probably benign 0.20
R5814:Spag9 UTSW 11 93,973,654 (GRCm39) missense possibly damaging 0.94
R5912:Spag9 UTSW 11 93,935,251 (GRCm39) missense probably damaging 0.98
R6038:Spag9 UTSW 11 94,002,918 (GRCm39) missense probably damaging 1.00
R6038:Spag9 UTSW 11 94,002,918 (GRCm39) missense probably damaging 1.00
R6269:Spag9 UTSW 11 93,935,333 (GRCm39) missense probably benign 0.05
R6294:Spag9 UTSW 11 93,984,311 (GRCm39) critical splice acceptor site probably null
R6389:Spag9 UTSW 11 93,977,137 (GRCm39) missense probably damaging 1.00
R6460:Spag9 UTSW 11 93,959,801 (GRCm39) missense probably damaging 1.00
R6482:Spag9 UTSW 11 93,984,328 (GRCm39) missense possibly damaging 0.94
R6860:Spag9 UTSW 11 93,972,196 (GRCm39) missense probably benign 0.25
R7086:Spag9 UTSW 11 93,988,690 (GRCm39) missense probably benign
R7179:Spag9 UTSW 11 93,980,258 (GRCm39) splice site probably null
R7225:Spag9 UTSW 11 93,988,184 (GRCm39) missense probably damaging 0.98
R7351:Spag9 UTSW 11 93,983,802 (GRCm39) missense probably benign 0.00
R7366:Spag9 UTSW 11 93,999,347 (GRCm39) missense possibly damaging 0.56
R7378:Spag9 UTSW 11 94,005,177 (GRCm39) critical splice donor site probably null
R7401:Spag9 UTSW 11 93,988,515 (GRCm39) missense probably benign
R7506:Spag9 UTSW 11 93,999,290 (GRCm39) missense probably damaging 1.00
R7507:Spag9 UTSW 11 93,958,906 (GRCm39) missense probably benign 0.00
R7513:Spag9 UTSW 11 94,002,909 (GRCm39) missense probably damaging 1.00
R7655:Spag9 UTSW 11 93,887,389 (GRCm39) missense possibly damaging 0.56
R7656:Spag9 UTSW 11 93,887,389 (GRCm39) missense possibly damaging 0.56
R7664:Spag9 UTSW 11 93,992,986 (GRCm39) critical splice donor site probably null
R7665:Spag9 UTSW 11 93,904,480 (GRCm39) missense probably damaging 0.98
R7862:Spag9 UTSW 11 94,002,892 (GRCm39) missense possibly damaging 0.69
R8074:Spag9 UTSW 11 94,002,877 (GRCm39) missense probably damaging 1.00
R8085:Spag9 UTSW 11 93,989,870 (GRCm39) missense probably benign
R8469:Spag9 UTSW 11 93,982,627 (GRCm39) missense probably damaging 1.00
R8547:Spag9 UTSW 11 94,013,647 (GRCm39) missense possibly damaging 0.84
R8709:Spag9 UTSW 11 93,958,916 (GRCm39) missense probably benign 0.02
R8732:Spag9 UTSW 11 93,962,514 (GRCm39) critical splice donor site probably null
R8899:Spag9 UTSW 11 93,983,695 (GRCm39) missense probably damaging 1.00
R8983:Spag9 UTSW 11 93,958,815 (GRCm39) missense probably benign
R9043:Spag9 UTSW 11 93,951,085 (GRCm39) missense
R9050:Spag9 UTSW 11 93,935,294 (GRCm39) missense probably damaging 0.97
R9502:Spag9 UTSW 11 93,959,792 (GRCm39) missense probably damaging 1.00
R9575:Spag9 UTSW 11 93,962,409 (GRCm39) missense probably damaging 0.99
R9667:Spag9 UTSW 11 93,887,119 (GRCm39) missense possibly damaging 0.83
R9683:Spag9 UTSW 11 93,988,568 (GRCm39) missense probably damaging 1.00
R9774:Spag9 UTSW 11 94,005,062 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAAGTTAACTTGGGCATGC -3'
(R):5'- TTCTCCTAGTGAACCCTCAGGC -3'

Sequencing Primer
(F):5'- AACTTGGGCATGCTTTTTGGAGAC -3'
(R):5'- CCTCAGGCAGGGTTTGG -3'
Posted On 2018-05-24