Incidental Mutation 'R6421:Adgrf4'
ID518196
Institutional Source Beutler Lab
Gene Symbol Adgrf4
Ensembl Gene ENSMUSG00000023918
Gene Nameadhesion G protein-coupled receptor F4
Synonyms4632435A09Rik, Gpr115
MMRRC Submission 044420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6421 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location42656891-42692284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42672501 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 97 (F97I)
Ref Sequence ENSEMBL: ENSMUSP00000133261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024711] [ENSMUST00000164524] [ENSMUST00000167993] [ENSMUST00000170723]
Predicted Effect probably damaging
Transcript: ENSMUST00000024711
AA Change: F97I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024711
Gene: ENSMUSG00000023918
AA Change: F97I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164524
SMART Domains Protein: ENSMUSP00000129114
Gene: ENSMUSG00000023918

DomainStartEndE-ValueType
SCOP:g1qd6.1 20 44 1e-2 SMART
low complexity region 54 64 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167993
AA Change: F97I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132890
Gene: ENSMUSG00000023918
AA Change: F97I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 5.9e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170723
AA Change: F97I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133261
Gene: ENSMUSG00000023918
AA Change: F97I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 9.2e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sequence analysis of this gene suggests that it is encodes a member of the superfamily of G protein-couple receptors. G protein-coupled receptors typically contain seven hydrophobic transmembrane domains, interact with guanine nucleotide binding regulatory proteins, and detect molecules outside the cell and act to transduce these signals into intracellular responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,508,736 S2160P possibly damaging Het
Anapc15-ps T C 10: 95,673,214 D68G probably benign Het
Arel1 T C 12: 84,934,345 Y296C probably damaging Het
Dcbld1 T C 10: 52,286,354 I147T probably damaging Het
Frem1 G A 4: 82,994,128 T669I probably damaging Het
Gm7276 T C 18: 77,185,670 probably benign Het
Gm8765 A G 13: 50,701,951 R542G probably benign Het
Grin2c A C 11: 115,251,130 M821R probably damaging Het
Lrp1b A T 2: 40,889,270 C2587S probably damaging Het
Lrriq4 T C 3: 30,650,402 L193P probably damaging Het
Myo3b A G 2: 70,313,356 S1011G probably benign Het
Olfr782 A T 10: 129,351,501 K313* probably null Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Ptprj A G 2: 90,471,140 I123T possibly damaging Het
Scn1a T G 2: 66,272,927 K1985N probably damaging Het
Serpinb9f A C 13: 33,334,533 I339L probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Stx4a C A 7: 127,846,501 T193K probably damaging Het
Traf3ip2 T C 10: 39,639,404 probably null Het
Wwc2 A T 8: 47,900,746 Y118N probably damaging Het
Xpo1 A G 11: 23,291,490 T846A possibly damaging Het
Zfp616 A G 11: 74,083,870 N413D possibly damaging Het
Other mutations in Adgrf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adgrf4 APN 17 42666656 missense probably damaging 1.00
IGL00474:Adgrf4 APN 17 42675759 missense probably damaging 0.97
IGL00913:Adgrf4 APN 17 42666902 missense possibly damaging 0.81
IGL02134:Adgrf4 APN 17 42669690 missense probably damaging 1.00
IGL02225:Adgrf4 APN 17 42663378 critical splice donor site probably null
IGL02423:Adgrf4 APN 17 42672576 missense probably benign 0.06
IGL02945:Adgrf4 APN 17 42667366 missense probably benign
R0329:Adgrf4 UTSW 17 42667313 missense probably damaging 1.00
R0330:Adgrf4 UTSW 17 42667313 missense probably damaging 1.00
R1595:Adgrf4 UTSW 17 42667873 missense probably benign 0.09
R1739:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1762:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1783:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1785:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2038:Adgrf4 UTSW 17 42667863 missense probably damaging 1.00
R2069:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2140:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2142:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2230:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2232:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2288:Adgrf4 UTSW 17 42667511 missense probably benign
R3107:Adgrf4 UTSW 17 42666867 nonsense probably null
R3732:Adgrf4 UTSW 17 42672581 missense probably damaging 1.00
R4003:Adgrf4 UTSW 17 42669759 missense probably damaging 1.00
R4158:Adgrf4 UTSW 17 42667677 missense probably benign
R4160:Adgrf4 UTSW 17 42667677 missense probably benign
R4163:Adgrf4 UTSW 17 42667586 missense probably benign
R4865:Adgrf4 UTSW 17 42667265 missense probably damaging 1.00
R4940:Adgrf4 UTSW 17 42666529 missense possibly damaging 0.90
R5411:Adgrf4 UTSW 17 42667213 missense probably damaging 1.00
R5512:Adgrf4 UTSW 17 42667285 missense probably benign 0.03
R7089:Adgrf4 UTSW 17 42666533 missense possibly damaging 0.95
R7261:Adgrf4 UTSW 17 42667435 missense probably benign 0.01
R7359:Adgrf4 UTSW 17 42667112 missense possibly damaging 0.78
R7502:Adgrf4 UTSW 17 42669657 missense possibly damaging 0.53
R7522:Adgrf4 UTSW 17 42669784 missense probably benign 0.04
R7555:Adgrf4 UTSW 17 42672603 missense probably benign 0.16
R7567:Adgrf4 UTSW 17 42667442 missense probably benign
R7743:Adgrf4 UTSW 17 42672562 nonsense probably null
X0027:Adgrf4 UTSW 17 42667528 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCACCCAAGTCCGGAACTTATTC -3'
(R):5'- AGGCATTCGTCAGAGTGTGG -3'

Sequencing Primer
(F):5'- TCCGGAACTTATTCTTTATGAGAGG -3'
(R):5'- GTGGAAATGGTAATTTGACCTCTGAC -3'
Posted On2018-05-24