Incidental Mutation 'R6422:Tyw5'
ID 518198
Institutional Source Beutler Lab
Gene Symbol Tyw5
Ensembl Gene ENSMUSG00000048495
Gene Name tRNA-yW synthesizing protein 5
Synonyms 1110034B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R6422 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 57388237-57407101 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 57401411 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 64 (A64V)
Ref Sequence ENSEMBL: ENSMUSP00000125386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027114] [ENSMUST00000079998] [ENSMUST00000160118] [ENSMUST00000160837] [ENSMUST00000162686]
AlphaFold A2RSX7
Predicted Effect probably benign
Transcript: ENSMUST00000027114
SMART Domains Protein: ENSMUSP00000027114
Gene: ENSMUSG00000025971

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Blast:Tim44 131 210 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000079998
AA Change: A64V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000078912
Gene: ENSMUSG00000048495
AA Change: A64V

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097732
Predicted Effect probably damaging
Transcript: ENSMUST00000160118
AA Change: A64V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125386
Gene: ENSMUSG00000048495
AA Change: A64V

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160837
AA Change: A58V

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128576
Gene: ENSMUSG00000048495
AA Change: A58V

DomainStartEndE-ValueType
JmjC 103 255 2.25e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161780
SMART Domains Protein: ENSMUSP00000125487
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162686
AA Change: A64V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000125427
Gene: ENSMUSG00000048495
AA Change: A64V

DomainStartEndE-ValueType
JmjC 105 265 5.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163039
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik T A 4: 153,960,924 F137I probably damaging Het
Adam11 A G 11: 102,774,283 K417R possibly damaging Het
Btbd9 G A 17: 30,530,256 A28V probably benign Het
Cabin1 A G 10: 75,656,792 Y1890H probably damaging Het
Cep162 G T 9: 87,232,016 N334K possibly damaging Het
Cep85l A T 10: 53,291,780 M634K possibly damaging Het
Col20a1 C A 2: 181,014,819 T1161N possibly damaging Het
Dip2b T A 15: 100,199,011 D1155E probably damaging Het
Dlst T A 12: 85,130,885 probably null Het
Dsc1 A C 18: 20,095,033 L422R probably damaging Het
Gatsl2 T A 5: 134,135,710 M170K probably benign Het
Gcn1l1 T C 5: 115,609,544 W1699R probably damaging Het
Gm14443 G A 2: 175,170,381 Q91* probably null Het
Gm8159 T C 14: 4,635,211 I143T probably damaging Het
Il4i1 G T 7: 44,840,136 A442S probably damaging Het
Kif26a T G 12: 112,168,875 L337R possibly damaging Het
Lat2 T C 5: 134,603,161 D144G probably benign Het
Ndst1 G T 18: 60,702,953 H419Q probably benign Het
Notch4 T C 17: 34,584,559 I1484T probably benign Het
Olfr620 T G 7: 103,612,014 E113A probably damaging Het
Paxbp1 A T 16: 91,023,444 M697K probably benign Het
Plxnb1 A G 9: 109,108,924 Y1246C probably damaging Het
Prr5 C T 15: 84,693,804 R96C probably damaging Het
Ptpn7 G T 1: 135,134,502 C62F probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sall2 A C 14: 52,312,724 *1003G probably null Het
Slc5a4b C A 10: 76,103,862 V147F probably damaging Het
Snapc4 A G 2: 26,368,303 W702R probably benign Het
Tbc1d32 A T 10: 56,028,061 C1203* probably null Het
Tmprss11d T A 5: 86,309,425 Y125F probably damaging Het
Tpp1 G A 7: 105,746,956 T512I probably benign Het
Other mutations in Tyw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Tyw5 APN 1 57388553 nonsense probably null
IGL01565:Tyw5 APN 1 57394081 missense probably damaging 1.00
IGL01675:Tyw5 APN 1 57388632 missense possibly damaging 0.94
IGL01915:Tyw5 APN 1 57401469 missense probably damaging 0.99
IGL02320:Tyw5 APN 1 57396725 critical splice donor site probably null
IGL02427:Tyw5 APN 1 57388725 missense possibly damaging 0.68
PIT4520001:Tyw5 UTSW 1 57388515 missense probably damaging 1.00
R0053:Tyw5 UTSW 1 57401438 missense probably damaging 0.97
R0053:Tyw5 UTSW 1 57401438 missense probably damaging 0.97
R2421:Tyw5 UTSW 1 57396748 missense possibly damaging 0.58
R2422:Tyw5 UTSW 1 57396748 missense possibly damaging 0.58
R2997:Tyw5 UTSW 1 57388641 missense probably damaging 1.00
R3974:Tyw5 UTSW 1 57391528 missense probably damaging 1.00
R4235:Tyw5 UTSW 1 57388488 utr 3 prime probably benign
R4630:Tyw5 UTSW 1 57388527 missense probably damaging 0.96
R5014:Tyw5 UTSW 1 57406845 start gained probably benign
R5099:Tyw5 UTSW 1 57388705 missense probably damaging 0.99
R5162:Tyw5 UTSW 1 57401459 missense probably damaging 1.00
R6389:Tyw5 UTSW 1 57391499 missense probably damaging 1.00
R6524:Tyw5 UTSW 1 57388731 missense possibly damaging 0.67
R6908:Tyw5 UTSW 1 57401523 missense probably damaging 1.00
R7633:Tyw5 UTSW 1 57393485 missense probably benign 0.01
R7997:Tyw5 UTSW 1 57388524 missense probably benign 0.03
R9218:Tyw5 UTSW 1 57396789 missense probably damaging 0.97
X0018:Tyw5 UTSW 1 57390663 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGTGGAAAATGTCTCTGTAC -3'
(R):5'- GCTGAGATGAAAGCCACACTCTG -3'

Sequencing Primer
(F):5'- CAGAATTCTTGTCGTTTAAGCCAC -3'
(R):5'- CACTCTGATACCAAGGAAGTTGTTG -3'
Posted On 2018-05-24