Incidental Mutation 'R6422:Cep162'
ID518212
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6422 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87232016 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 334 (N334K)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093802
AA Change: N334K

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: N334K

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188289
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik T A 4: 153,960,924 F137I probably damaging Het
Adam11 A G 11: 102,774,283 K417R possibly damaging Het
Btbd9 G A 17: 30,530,256 A28V probably benign Het
Cabin1 A G 10: 75,656,792 Y1890H probably damaging Het
Cep85l A T 10: 53,291,780 M634K possibly damaging Het
Col20a1 C A 2: 181,014,819 T1161N possibly damaging Het
Dip2b T A 15: 100,199,011 D1155E probably damaging Het
Dlst T A 12: 85,130,885 probably null Het
Dsc1 A C 18: 20,095,033 L422R probably damaging Het
Gatsl2 T A 5: 134,135,710 M170K probably benign Het
Gcn1l1 T C 5: 115,609,544 W1699R probably damaging Het
Gm14443 G A 2: 175,170,381 Q91* probably null Het
Gm8159 T C 14: 4,635,211 I143T probably damaging Het
Il4i1 G T 7: 44,840,136 A442S probably damaging Het
Kif26a T G 12: 112,168,875 L337R possibly damaging Het
Lat2 T C 5: 134,603,161 D144G probably benign Het
Ndst1 G T 18: 60,702,953 H419Q probably benign Het
Notch4 T C 17: 34,584,559 I1484T probably benign Het
Olfr620 T G 7: 103,612,014 E113A probably damaging Het
Paxbp1 A T 16: 91,023,444 M697K probably benign Het
Plxnb1 A G 9: 109,108,924 Y1246C probably damaging Het
Prr5 C T 15: 84,693,804 R96C probably damaging Het
Ptpn7 G T 1: 135,134,502 C62F probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sall2 A C 14: 52,312,724 *1003G probably null Het
Slc5a4b C A 10: 76,103,862 V147F probably damaging Het
Snapc4 A G 2: 26,368,303 W702R probably benign Het
Tbc1d32 A T 10: 56,028,061 C1203* probably null Het
Tmprss11d T A 5: 86,309,425 Y125F probably damaging Het
Tpp1 G A 7: 105,746,956 T512I probably benign Het
Tyw5 G A 1: 57,401,411 A64V probably damaging Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
circus UTSW 9 87206862 missense probably damaging 1.00
moscow UTSW 9 87193697 missense probably damaging 1.00
smiley UTSW 9 87217081 nonsense probably null
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R7949:Cep162 UTSW 9 87206848 missense probably benign 0.04
R8351:Cep162 UTSW 9 87192850 nonsense probably null
R8451:Cep162 UTSW 9 87192850 nonsense probably null
R8552:Cep162 UTSW 9 87244308 missense probably benign 0.34
R8755:Cep162 UTSW 9 87232011 missense probably benign 0.02
R8762:Cep162 UTSW 9 87227261 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTTCATTTGATCACGCCC -3'
(R):5'- GACTCCGGAATGACTCTGTTTTG -3'

Sequencing Primer
(F):5'- TTTGATCACGCCCATTACATTCAAAC -3'
(R):5'- GCACAGGAGTTGTATTTATTTCCAC -3'
Posted On2018-05-24