Incidental Mutation 'R6422:Kif26a'
ID518220
Institutional Source Beutler Lab
Gene Symbol Kif26a
Ensembl Gene ENSMUSG00000021294
Gene Namekinesin family member 26A
SynonymsN-11 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R6422 (G1)
Quality Score105.008
Status Validated
Chromosome12
Chromosomal Location112146208-112181747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 112168875 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 337 (L337R)
Ref Sequence ENSEMBL: ENSMUSP00000119482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128402]
Predicted Effect possibly damaging
Transcript: ENSMUST00000128402
AA Change: L337R

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119482
Gene: ENSMUSG00000021294
AA Change: L337R

DomainStartEndE-ValueType
low complexity region 238 248 N/A INTRINSIC
low complexity region 279 297 N/A INTRINSIC
KISc 362 726 9.57e-35 SMART
low complexity region 727 739 N/A INTRINSIC
low complexity region 740 754 N/A INTRINSIC
low complexity region 932 957 N/A INTRINSIC
low complexity region 1005 1012 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1328 1360 N/A INTRINSIC
low complexity region 1458 1471 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1519 1538 N/A INTRINSIC
low complexity region 1574 1587 N/A INTRINSIC
low complexity region 1664 1675 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
coiled coil region 1780 1812 N/A INTRINSIC
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.8%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death associated with megacolon and hyperganglionosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik T A 4: 153,960,924 F137I probably damaging Het
Adam11 A G 11: 102,774,283 K417R possibly damaging Het
Btbd9 G A 17: 30,530,256 A28V probably benign Het
Cabin1 A G 10: 75,656,792 Y1890H probably damaging Het
Cep162 G T 9: 87,232,016 N334K possibly damaging Het
Cep85l A T 10: 53,291,780 M634K possibly damaging Het
Col20a1 C A 2: 181,014,819 T1161N possibly damaging Het
Dip2b T A 15: 100,199,011 D1155E probably damaging Het
Dlst T A 12: 85,130,885 probably null Het
Dsc1 A C 18: 20,095,033 L422R probably damaging Het
Gatsl2 T A 5: 134,135,710 M170K probably benign Het
Gcn1l1 T C 5: 115,609,544 W1699R probably damaging Het
Gm14443 G A 2: 175,170,381 Q91* probably null Het
Gm8159 T C 14: 4,635,211 I143T probably damaging Het
Il4i1 G T 7: 44,840,136 A442S probably damaging Het
Lat2 T C 5: 134,603,161 D144G probably benign Het
Ndst1 G T 18: 60,702,953 H419Q probably benign Het
Notch4 T C 17: 34,584,559 I1484T probably benign Het
Olfr620 T G 7: 103,612,014 E113A probably damaging Het
Paxbp1 A T 16: 91,023,444 M697K probably benign Het
Plxnb1 A G 9: 109,108,924 Y1246C probably damaging Het
Prr5 C T 15: 84,693,804 R96C probably damaging Het
Ptpn7 G T 1: 135,134,502 C62F probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sall2 A C 14: 52,312,724 *1003G probably null Het
Slc5a4b C A 10: 76,103,862 V147F probably damaging Het
Snapc4 A G 2: 26,368,303 W702R probably benign Het
Tbc1d32 A T 10: 56,028,061 C1203* probably null Het
Tmprss11d T A 5: 86,309,425 Y125F probably damaging Het
Tpp1 G A 7: 105,746,956 T512I probably benign Het
Tyw5 G A 1: 57,401,411 A64V probably damaging Het
Other mutations in Kif26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Kif26a APN 12 112157632 missense probably damaging 0.97
IGL01734:Kif26a APN 12 112176828 missense probably benign 0.23
IGL01916:Kif26a APN 12 112176894 missense possibly damaging 0.49
IGL02080:Kif26a APN 12 112157566 missense probably damaging 1.00
IGL02138:Kif26a APN 12 112174850 missense probably damaging 1.00
IGL02145:Kif26a APN 12 112176975 missense probably benign 0.00
IGL02285:Kif26a APN 12 112157507 missense probably damaging 1.00
IGL02393:Kif26a APN 12 112172664 missense probably damaging 1.00
IGL02445:Kif26a APN 12 112173743 missense probably damaging 1.00
IGL02865:Kif26a APN 12 112177615 nonsense probably null
IGL03057:Kif26a APN 12 112175774 nonsense probably null
IGL03204:Kif26a APN 12 112174779 missense probably damaging 1.00
R0013:Kif26a UTSW 12 112177880 missense probably benign 0.03
R0034:Kif26a UTSW 12 112168963 splice site probably benign
R0089:Kif26a UTSW 12 112177403 missense probably damaging 0.98
R0111:Kif26a UTSW 12 112163337 splice site probably benign
R0220:Kif26a UTSW 12 112157390 missense probably damaging 0.98
R0346:Kif26a UTSW 12 112179348 missense probably null 0.09
R0383:Kif26a UTSW 12 112178076 missense possibly damaging 0.94
R0478:Kif26a UTSW 12 112175789 missense probably damaging 1.00
R0494:Kif26a UTSW 12 112179471 splice site probably null
R1163:Kif26a UTSW 12 112179945 missense probably benign 0.08
R1450:Kif26a UTSW 12 112173852 missense probably damaging 1.00
R1512:Kif26a UTSW 12 112146955 missense possibly damaging 0.47
R1616:Kif26a UTSW 12 112157246 critical splice acceptor site probably null
R1723:Kif26a UTSW 12 112173858 missense possibly damaging 0.67
R1728:Kif26a UTSW 12 112176785 missense possibly damaging 0.95
R1729:Kif26a UTSW 12 112176785 missense possibly damaging 0.95
R1903:Kif26a UTSW 12 112175540 missense probably damaging 1.00
R2283:Kif26a UTSW 12 112177353 missense possibly damaging 0.66
R3862:Kif26a UTSW 12 112179889 missense probably benign 0.30
R3906:Kif26a UTSW 12 112176890 missense probably benign
R4050:Kif26a UTSW 12 112179916 missense probably benign 0.08
R4270:Kif26a UTSW 12 112173414 missense probably damaging 1.00
R4271:Kif26a UTSW 12 112173414 missense probably damaging 1.00
R4731:Kif26a UTSW 12 112175573 missense probably benign
R4732:Kif26a UTSW 12 112175573 missense probably benign
R4733:Kif26a UTSW 12 112175573 missense probably benign
R4908:Kif26a UTSW 12 112157342 missense probably damaging 1.00
R4946:Kif26a UTSW 12 112177794 missense probably damaging 0.99
R5566:Kif26a UTSW 12 112157354 missense probably damaging 1.00
R6280:Kif26a UTSW 12 112174869 missense probably damaging 0.99
R6513:Kif26a UTSW 12 112175492 missense probably damaging 0.97
R6860:Kif26a UTSW 12 112146829 missense probably damaging 1.00
R6879:Kif26a UTSW 12 112177653 missense probably benign
R7127:Kif26a UTSW 12 112178145 missense probably damaging 1.00
R7366:Kif26a UTSW 12 112163542 critical splice donor site probably null
R7595:Kif26a UTSW 12 112179325 missense probably benign 0.30
R7630:Kif26a UTSW 12 112175697 missense probably damaging 1.00
R7784:Kif26a UTSW 12 112178147 missense possibly damaging 0.66
X0027:Kif26a UTSW 12 112176070 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTGGCTGTTTCCTCAGAGTGAC -3'
(R):5'- GTCCTTAGCTCTGCCAACTG -3'

Sequencing Primer
(F):5'- TCAGAGTGACTCTCCACGTG -3'
(R):5'- AACTGGCTTACCGTGGC -3'
Posted On2018-05-24