Incidental Mutation 'R6422:Prr5'
ID518223
Institutional Source Beutler Lab
Gene Symbol Prr5
Ensembl Gene ENSMUSG00000036106
Gene Nameproline rich 5 (renal)
SynonymsC030017C09Rik, Protor-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6422 (G1)
Quality Score121.008
Status Validated
Chromosome15
Chromosomal Location84669620-84703673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84693804 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 96 (R96C)
Ref Sequence ENSEMBL: ENSMUSP00000127890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065499] [ENSMUST00000171460]
Predicted Effect probably damaging
Transcript: ENSMUST00000065499
AA Change: R105C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066396
Gene: ENSMUSG00000036106
AA Change: R105C

DomainStartEndE-ValueType
Pfam:HbrB 38 144 6.9e-17 PFAM
low complexity region 333 344 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171460
AA Change: R96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127890
Gene: ENSMUSG00000036106
AA Change: R96C

DomainStartEndE-ValueType
Pfam:HbrB 27 159 1.3e-36 PFAM
low complexity region 324 335 N/A INTRINSIC
Meta Mutation Damage Score 0.2747 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a proline-rich domain. This gene is located in a region of chromosome 22 reported to contain a tumor suppressor gene that may be involved in breast and colorectal tumorigenesis. The protein is a component of the mammalian target of rapamycin complex 2 (mTORC2), and it regulates platelet-derived growth factor (PDGF) receptor beta expression and PDGF signaling to Akt and S6K1. Alternative splicing and the use of alternative promoters results in transcripts encoding different isoforms. Read-through transcripts from this gene into the downstream Rho GTPase activating protein 8 (ARHGAP8) gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik T A 4: 153,960,924 F137I probably damaging Het
Adam11 A G 11: 102,774,283 K417R possibly damaging Het
Btbd9 G A 17: 30,530,256 A28V probably benign Het
Cabin1 A G 10: 75,656,792 Y1890H probably damaging Het
Cep162 G T 9: 87,232,016 N334K possibly damaging Het
Cep85l A T 10: 53,291,780 M634K possibly damaging Het
Col20a1 C A 2: 181,014,819 T1161N possibly damaging Het
Dip2b T A 15: 100,199,011 D1155E probably damaging Het
Dlst T A 12: 85,130,885 probably null Het
Dsc1 A C 18: 20,095,033 L422R probably damaging Het
Gatsl2 T A 5: 134,135,710 M170K probably benign Het
Gcn1l1 T C 5: 115,609,544 W1699R probably damaging Het
Gm14443 G A 2: 175,170,381 Q91* probably null Het
Gm8159 T C 14: 4,635,211 I143T probably damaging Het
Il4i1 G T 7: 44,840,136 A442S probably damaging Het
Kif26a T G 12: 112,168,875 L337R possibly damaging Het
Lat2 T C 5: 134,603,161 D144G probably benign Het
Ndst1 G T 18: 60,702,953 H419Q probably benign Het
Notch4 T C 17: 34,584,559 I1484T probably benign Het
Olfr620 T G 7: 103,612,014 E113A probably damaging Het
Paxbp1 A T 16: 91,023,444 M697K probably benign Het
Plxnb1 A G 9: 109,108,924 Y1246C probably damaging Het
Ptpn7 G T 1: 135,134,502 C62F probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sall2 A C 14: 52,312,724 *1003G probably null Het
Slc5a4b C A 10: 76,103,862 V147F probably damaging Het
Snapc4 A G 2: 26,368,303 W702R probably benign Het
Tbc1d32 A T 10: 56,028,061 C1203* probably null Het
Tmprss11d T A 5: 86,309,425 Y125F probably damaging Het
Tpp1 G A 7: 105,746,956 T512I probably benign Het
Tyw5 G A 1: 57,401,411 A64V probably damaging Het
Other mutations in Prr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prr5 APN 15 84699655 missense possibly damaging 0.47
IGL02656:Prr5 APN 15 84699136 missense probably damaging 1.00
R0234:Prr5 UTSW 15 84703121 missense probably damaging 1.00
R0234:Prr5 UTSW 15 84703121 missense probably damaging 1.00
R0389:Prr5 UTSW 15 84702951 missense probably benign 0.00
R0514:Prr5 UTSW 15 84702766 missense probably benign 0.19
R1414:Prr5 UTSW 15 84699711 nonsense probably null
R2027:Prr5 UTSW 15 84701379 missense probably damaging 0.99
R2230:Prr5 UTSW 15 84702780 missense probably benign 0.15
R2231:Prr5 UTSW 15 84702780 missense probably benign 0.15
R2232:Prr5 UTSW 15 84702780 missense probably benign 0.15
R3498:Prr5 UTSW 15 84703144 missense probably benign 0.12
R3791:Prr5 UTSW 15 84681216 missense probably damaging 1.00
R3910:Prr5 UTSW 15 84703144 missense probably benign 0.12
R5514:Prr5 UTSW 15 84702895 missense probably benign 0.01
R5911:Prr5 UTSW 15 84701434 nonsense probably null
R6085:Prr5 UTSW 15 84687905 missense probably damaging 1.00
R6187:Prr5 UTSW 15 84693772 missense probably damaging 1.00
R6394:Prr5 UTSW 15 84699724 missense probably damaging 0.99
R6631:Prr5 UTSW 15 84702777 missense probably damaging 0.99
R8113:Prr5 UTSW 15 84693792 missense probably damaging 1.00
R8268:Prr5 UTSW 15 84702991 missense probably benign 0.02
R8328:Prr5 UTSW 15 84703186 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTCTGTGACCTGTGACAGC -3'
(R):5'- TGCAGACTCTCTCCAAGGTC -3'

Sequencing Primer
(F):5'- TCTAGGCTGGCCTCTCG -3'
(R):5'- TCCCAGTCCAGACCTCAGTC -3'
Posted On2018-05-24