Incidental Mutation 'R6422:Ndst1'
ID518229
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonymsglucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6422 (G1)
Quality Score193.009
Status Validated
Chromosome18
Chromosomal Location60685978-60713389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 60702953 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 419 (H419Q)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
Predicted Effect probably benign
Transcript: ENSMUST00000169273
AA Change: H419Q

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: H419Q

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik T A 4: 153,960,924 F137I probably damaging Het
Adam11 A G 11: 102,774,283 K417R possibly damaging Het
Btbd9 G A 17: 30,530,256 A28V probably benign Het
Cabin1 A G 10: 75,656,792 Y1890H probably damaging Het
Cep162 G T 9: 87,232,016 N334K possibly damaging Het
Cep85l A T 10: 53,291,780 M634K possibly damaging Het
Col20a1 C A 2: 181,014,819 T1161N possibly damaging Het
Dip2b T A 15: 100,199,011 D1155E probably damaging Het
Dlst T A 12: 85,130,885 probably null Het
Dsc1 A C 18: 20,095,033 L422R probably damaging Het
Gatsl2 T A 5: 134,135,710 M170K probably benign Het
Gcn1l1 T C 5: 115,609,544 W1699R probably damaging Het
Gm14443 G A 2: 175,170,381 Q91* probably null Het
Gm8159 T C 14: 4,635,211 I143T probably damaging Het
Il4i1 G T 7: 44,840,136 A442S probably damaging Het
Kif26a T G 12: 112,168,875 L337R possibly damaging Het
Lat2 T C 5: 134,603,161 D144G probably benign Het
Notch4 T C 17: 34,584,559 I1484T probably benign Het
Olfr620 T G 7: 103,612,014 E113A probably damaging Het
Paxbp1 A T 16: 91,023,444 M697K probably benign Het
Plxnb1 A G 9: 109,108,924 Y1246C probably damaging Het
Prr5 C T 15: 84,693,804 R96C probably damaging Het
Ptpn7 G T 1: 135,134,502 C62F probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sall2 A C 14: 52,312,724 *1003G probably null Het
Slc5a4b C A 10: 76,103,862 V147F probably damaging Het
Snapc4 A G 2: 26,368,303 W702R probably benign Het
Tbc1d32 A T 10: 56,028,061 C1203* probably null Het
Tmprss11d T A 5: 86,309,425 Y125F probably damaging Het
Tpp1 G A 7: 105,746,956 T512I probably benign Het
Tyw5 G A 1: 57,401,411 A64V probably damaging Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60707956 missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60700445 missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60713126 missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60699546 missense probably benign 0.05
IGL03200:Ndst1 APN 18 60699539 missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60700359 splice site probably benign
R0899:Ndst1 UTSW 18 60707882 missense probably benign 0.00
R1104:Ndst1 UTSW 18 60697146 missense probably damaging 0.98
R1371:Ndst1 UTSW 18 60707647 missense possibly damaging 0.90
R1456:Ndst1 UTSW 18 60713205 missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60697170 missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60698504 missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60695508 missense probably damaging 1.00
R1718:Ndst1 UTSW 18 60707803 missense probably damaging 0.99
R1772:Ndst1 UTSW 18 60702837 missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60712721 critical splice donor site probably null
R2079:Ndst1 UTSW 18 60695509 missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60691253 missense probably benign 0.01
R2127:Ndst1 UTSW 18 60691208 missense probably benign 0.00
R2875:Ndst1 UTSW 18 60690047 missense probably damaging 1.00
R3798:Ndst1 UTSW 18 60713166 missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3951:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3952:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R4868:Ndst1 UTSW 18 60695476 missense probably benign 0.07
R4898:Ndst1 UTSW 18 60691987 missense probably benign 0.12
R4988:Ndst1 UTSW 18 60702933 missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60705132 missense probably benign 0.03
R5337:Ndst1 UTSW 18 60690007 missense probably damaging 1.00
R5467:Ndst1 UTSW 18 60692021 missense probably benign
R5830:Ndst1 UTSW 18 60703838 missense probably damaging 1.00
R5968:Ndst1 UTSW 18 60713076 missense probably benign
R6241:Ndst1 UTSW 18 60703829 missense probably damaging 0.99
R7099:Ndst1 UTSW 18 60695500 missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60697184 missense probably damaging 1.00
V8831:Ndst1 UTSW 18 60702927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGCCATTGTGGATAAAGC -3'
(R):5'- GCTAGGTTCCAGGTGTATGTCC -3'

Sequencing Primer
(F):5'- TCAGATGTGGGTACTCCT -3'
(R):5'- TGTATGTCCTGAATCAGAGTCAG -3'
Posted On2018-05-24