Incidental Mutation 'R6423:Kcna3'
ID518231
Institutional Source Beutler Lab
Gene Symbol Kcna3
Ensembl Gene ENSMUSG00000047959
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 3
SynonymsKv1.3, Mk-3, Kca1-3
MMRRC Submission 044386-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R6423 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location107036169-107038070 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 107036842 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 140 (Y140*)
Ref Sequence ENSEMBL: ENSMUSP00000050680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052718]
Predicted Effect probably null
Transcript: ENSMUST00000052718
AA Change: Y140*
SMART Domains Protein: ENSMUSP00000050680
Gene: ENSMUSG00000047959
AA Change: Y140*

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
BTB 57 157 6.9e-10 SMART
Pfam:Ion_trans 186 444 4.2e-54 PFAM
Pfam:Ion_trans_2 352 437 2.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070085
SMART Domains Protein: ENSMUSP00000066165
Gene: ENSMUSG00000056145

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182414
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display no apparent immune system defects. Mice homozygous for a different knock-out allele show reduced body weight, increased basal metabolic rate, resistance to diet-induced obesity, increased insulin sensitivity, and altered peripheral glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,778 M2842L probably benign Het
Actl7b T C 4: 56,741,213 I48M probably benign Het
Adgrb1 G T 15: 74,588,143 probably null Het
Arhgap10 G T 8: 77,517,757 S9R probably damaging Het
Bcl11b T C 12: 107,915,419 E807G possibly damaging Het
C130060K24Rik A G 6: 65,456,093 N299S probably benign Het
Chia1 A G 3: 106,128,988 T295A possibly damaging Het
Cnrip1 T C 11: 17,052,350 probably null Het
Ets1 A G 9: 32,738,315 K316R probably damaging Het
Fbxo4 C T 15: 3,965,792 V357I possibly damaging Het
Flnc G A 6: 29,445,156 probably null Het
Foxf1 G A 8: 121,085,095 G233R possibly damaging Het
H2-DMa A G 17: 34,137,196 I57M probably benign Het
Insr C T 8: 3,173,566 V856I probably benign Het
Iqub T C 6: 24,491,529 D386G probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mgam A G 6: 40,677,045 Y844C possibly damaging Het
Nbeal2 T C 9: 110,625,994 Q2605R probably damaging Het
Ncor2 A G 5: 125,087,902 I316T unknown Het
Nell2 A T 15: 95,527,282 F63Y probably damaging Het
Olfr323 T C 11: 58,625,363 I228V probably damaging Het
Zfp386 A G 12: 116,060,113 I449V probably damaging Het
Other mutations in Kcna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Kcna3 APN 3 107037156 missense probably benign 0.33
IGL00562:Kcna3 APN 3 107036730 missense probably damaging 1.00
IGL01106:Kcna3 APN 3 107037864 missense possibly damaging 0.89
IGL01318:Kcna3 APN 3 107037978 missense probably benign 0.03
IGL02253:Kcna3 APN 3 107037411 missense probably damaging 1.00
IGL03379:Kcna3 APN 3 107037205 missense probably benign 0.05
IGL02802:Kcna3 UTSW 3 107037053 missense probably damaging 0.99
IGL03014:Kcna3 UTSW 3 107037890 missense probably benign 0.00
R0393:Kcna3 UTSW 3 107036999 missense probably damaging 1.00
R1591:Kcna3 UTSW 3 107037029 missense probably damaging 1.00
R1922:Kcna3 UTSW 3 107037935 missense possibly damaging 0.47
R1950:Kcna3 UTSW 3 107037672 missense probably damaging 1.00
R3847:Kcna3 UTSW 3 107036696 missense possibly damaging 0.57
R4912:Kcna3 UTSW 3 107037891 missense probably benign
R6261:Kcna3 UTSW 3 107037950 missense possibly damaging 0.53
R6271:Kcna3 UTSW 3 107037606 missense probably damaging 1.00
R6334:Kcna3 UTSW 3 107036424 start codon destroyed probably null
R6850:Kcna3 UTSW 3 107037159 missense probably damaging 1.00
R6901:Kcna3 UTSW 3 107036568 missense probably benign 0.00
R7193:Kcna3 UTSW 3 107036537 missense probably benign 0.02
R7524:Kcna3 UTSW 3 107037207 missense probably damaging 1.00
Z1088:Kcna3 UTSW 3 107036953 missense probably damaging 1.00
Z1176:Kcna3 UTSW 3 107037266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAACATCTCTGGGCTGC -3'
(R):5'- TGACCAGCACTGACACAATG -3'

Sequencing Primer
(F):5'- TTCGAGACGCAGCTCAAG -3'
(R):5'- GCACTGACACAATGGCAATG -3'
Posted On2018-05-24