Incidental Mutation 'R6424:Serpinb3c'
ID518254
Institutional Source Beutler Lab
Gene Symbol Serpinb3c
Ensembl Gene ENSMUSG00000073601
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms1110001H02Rik, Scca2, Serpinb4, ovalbumin, 1110013A16Rik
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location107271201-107278371 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 107271629 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tyrosine at position 387 (*387Y)
Ref Sequence ENSEMBL: ENSMUSP00000027565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027565] [ENSMUST00000166100]
Predicted Effect probably null
Transcript: ENSMUST00000027565
AA Change: *387Y
SMART Domains Protein: ENSMUSP00000027565
Gene: ENSMUSG00000073601
AA Change: *387Y

DomainStartEndE-ValueType
SERPIN 13 386 7.91e-169 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166100
SMART Domains Protein: ENSMUSP00000132370
Gene: ENSMUSG00000073602

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Serpinb3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Serpinb3c APN 1 107276260 critical splice donor site probably null
IGL01349:Serpinb3c APN 1 107272783 missense probably damaging 1.00
IGL01730:Serpinb3c APN 1 107273184 missense probably damaging 0.99
IGL01732:Serpinb3c APN 1 107271972 missense probably benign
IGL02184:Serpinb3c APN 1 107271918 missense probably damaging 0.96
IGL02742:Serpinb3c APN 1 107273142 nonsense probably null
IGL03131:Serpinb3c APN 1 107271727 missense probably benign 0.09
IGL03394:Serpinb3c APN 1 107271873 missense probably benign 0.00
R0207:Serpinb3c UTSW 1 107276992 missense probably benign 0.02
R0508:Serpinb3c UTSW 1 107276921 missense probably damaging 1.00
R1542:Serpinb3c UTSW 1 107272787 missense probably damaging 1.00
R1660:Serpinb3c UTSW 1 107271702 missense probably damaging 1.00
R1731:Serpinb3c UTSW 1 107271774 missense probably damaging 0.99
R2012:Serpinb3c UTSW 1 107271844 missense possibly damaging 0.92
R5361:Serpinb3c UTSW 1 107276931 nonsense probably null
R5464:Serpinb3c UTSW 1 107271704 missense probably damaging 0.99
R5636:Serpinb3c UTSW 1 107275014 missense possibly damaging 0.57
R5677:Serpinb3c UTSW 1 107271803 missense probably damaging 1.00
R5965:Serpinb3c UTSW 1 107276923 missense probably benign 0.01
R7132:Serpinb3c UTSW 1 107276951 missense probably damaging 0.96
R7161:Serpinb3c UTSW 1 107273162 missense probably null 1.00
R7319:Serpinb3c UTSW 1 107273087 missense possibly damaging 0.92
R7437:Serpinb3c UTSW 1 107271714 missense probably damaging 1.00
R7871:Serpinb3c UTSW 1 107273153 missense possibly damaging 0.95
R7954:Serpinb3c UTSW 1 107273153 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTTGAACATTTTCCCCAAGAG -3'
(R):5'- CAAGGTCTCGTGGTGTCTAAAG -3'

Sequencing Primer
(F):5'- CATTTTCCCCAAGAGAATGTATGG -3'
(R):5'- CTCGTGGTGTCTAAAGTTTTACAC -3'
Posted On2018-05-24