Incidental Mutation 'R6424:Cr1l'
ID518255
Institutional Source Beutler Lab
Gene Symbol Cr1l
Ensembl Gene ENSMUSG00000016481
Gene Namecomplement component (3b/4b) receptor 1-like
SynonymsmCRY, Crry
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location195097382-195131586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 195117815 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 184 (F184V)
Ref Sequence ENSEMBL: ENSMUSP00000074902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075451] [ENSMUST00000191775] [ENSMUST00000193094] [ENSMUST00000194062] [ENSMUST00000194111]
Predicted Effect probably damaging
Transcript: ENSMUST00000075451
AA Change: F184V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074902
Gene: ENSMUSG00000016481
AA Change: F184V

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
CCP 42 98 3.51e-6 SMART
CCP 103 160 1.61e-14 SMART
CCP 165 231 7.92e-14 SMART
CCP 237 293 5.23e-14 SMART
CCP 299 355 6.69e-12 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191775
AA Change: F124V

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141250
Gene: ENSMUSG00000016481
AA Change: F124V

DomainStartEndE-ValueType
Pfam:Sushi 1 38 9e-6 PFAM
CCP 43 100 8e-17 SMART
CCP 105 171 3.9e-16 SMART
CCP 177 233 2.6e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193094
AA Change: F184V

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142309
Gene: ENSMUSG00000016481
AA Change: F184V

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
CCP 42 98 1.7e-8 SMART
CCP 103 160 8e-17 SMART
CCP 165 231 3.9e-16 SMART
CCP 237 293 2.6e-16 SMART
CCP 299 355 3.3e-14 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194062
SMART Domains Protein: ENSMUSP00000142104
Gene: ENSMUSG00000016481

DomainStartEndE-ValueType
CCP 1 52 2.9e-9 SMART
CCP 58 114 3.3e-14 SMART
transmembrane domain 123 145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194111
AA Change: F146V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142069
Gene: ENSMUSG00000016481
AA Change: F146V

DomainStartEndE-ValueType
CCP 4 60 1.7e-8 SMART
CCP 65 122 8e-17 SMART
CCP 127 193 3.9e-16 SMART
CCP 199 255 2.6e-16 SMART
CCP 261 317 3.3e-14 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195586
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die by E16.5 with abnormal C3 deposition. Mice homozygous for a null allele activated in single positive thymocytes exhibit T cell lymphopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Cr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Cr1l APN 1 195129881 missense possibly damaging 0.86
IGL01988:Cr1l APN 1 195117550 missense probably damaging 1.00
IGL02412:Cr1l APN 1 195114772 missense probably damaging 0.97
IGL02412:Cr1l APN 1 195114766 missense probably damaging 1.00
IGL02707:Cr1l APN 1 195123711 missense probably benign 0.03
IGL02726:Cr1l APN 1 195129880 missense probably damaging 1.00
R0105:Cr1l UTSW 1 195112412 splice site probably benign
R0153:Cr1l UTSW 1 195114856 splice site probably benign
R0302:Cr1l UTSW 1 195117793 missense probably damaging 0.99
R1444:Cr1l UTSW 1 195131202 missense probably damaging 0.99
R1760:Cr1l UTSW 1 195114815 missense probably benign 0.01
R2402:Cr1l UTSW 1 195106902 missense probably benign 0.04
R4583:Cr1l UTSW 1 195129831 missense probably damaging 0.97
R5977:Cr1l UTSW 1 195114768 nonsense probably null
R6113:Cr1l UTSW 1 195131411 unclassified probably benign
R6324:Cr1l UTSW 1 195111122 missense probably benign 0.07
R7082:Cr1l UTSW 1 195123698 missense probably benign 0.36
R7174:Cr1l UTSW 1 195129189 missense probably benign 0.00
R7199:Cr1l UTSW 1 195117570 missense probably benign 0.20
X0020:Cr1l UTSW 1 195129853 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACTGCATTTTCAACATAGGGAG -3'
(R):5'- AGTCAGAGCACATGTTATTGTATGC -3'

Sequencing Primer
(F):5'- TTTTCAACATAGGGAGGAGGAGTAC -3'
(R):5'- GTTATTGTATGCATCTAAATGGCAAC -3'
Posted On2018-05-24