Incidental Mutation 'R6424:Olfr491'
ID518263
Institutional Source Beutler Lab
Gene Symbol Olfr491
Ensembl Gene ENSMUSG00000094612
Gene Nameolfactory receptor 491
SynonymsMOR204-11, GA_x6K02T2PBJ9-10646917-10647849
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108313451-108318827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108317205 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 104 (V104I)
Ref Sequence ENSEMBL: ENSMUSP00000150694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053179] [ENSMUST00000209545] [ENSMUST00000214605]
Predicted Effect probably benign
Transcript: ENSMUST00000053179
AA Change: V104I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000061188
Gene: ENSMUSG00000094612
AA Change: V104I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.4e-50 PFAM
Pfam:7tm_1 41 290 5.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209545
AA Change: V104I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000214605
AA Change: V104I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Olfr491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Olfr491 APN 7 108317518 missense probably benign 0.02
IGL01731:Olfr491 APN 7 108317475 missense probably benign 0.01
IGL02227:Olfr491 APN 7 108317201 nonsense probably null
IGL02624:Olfr491 APN 7 108316923 missense probably benign 0.38
IGL03164:Olfr491 APN 7 108317694 missense probably damaging 1.00
R0143:Olfr491 UTSW 7 108316995 missense probably benign 0.00
R0217:Olfr491 UTSW 7 108317298 missense probably benign 0.00
R0295:Olfr491 UTSW 7 108317685 missense probably benign 0.42
R2100:Olfr491 UTSW 7 108317554 missense probably benign 0.04
R2379:Olfr491 UTSW 7 108317292 missense probably benign 0.25
R4178:Olfr491 UTSW 7 108317358 missense probably damaging 1.00
R4365:Olfr491 UTSW 7 108317106 missense probably benign 0.02
R4734:Olfr491 UTSW 7 108317752 missense probably damaging 1.00
R4828:Olfr491 UTSW 7 108317470 missense probably benign 0.00
R6784:Olfr491 UTSW 7 108317782 missense probably damaging 0.98
R7109:Olfr491 UTSW 7 108317752 missense probably damaging 1.00
R7348:Olfr491 UTSW 7 108317713 missense possibly damaging 0.58
R7590:Olfr491 UTSW 7 108317179 missense probably benign 0.00
X0060:Olfr491 UTSW 7 108317220 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGATGATCCTACACTCTGTGTCATC -3'
(R):5'- CAGCCAGTAAATGTCCATGC -3'

Sequencing Primer
(F):5'- TGTCACCTTAGTAGGAAATATCAGC -3'
(R):5'- GTAAATGTCCATGCATTCACACAG -3'
Posted On2018-05-24