Incidental Mutation 'R6424:Haus8'
ID518265
Institutional Source Beutler Lab
Gene Symbol Haus8
Ensembl Gene ENSMUSG00000035439
Gene Name4HAUS augmin-like complex, subunit 8
SynonymsHice1, 2410004L22Rik
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location71248561-71272934 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 71251436 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 359 (W359*)
Ref Sequence ENSEMBL: ENSMUSP00000105698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035960] [ENSMUST00000110071] [ENSMUST00000123495]
Predicted Effect probably null
Transcript: ENSMUST00000035960
AA Change: W360*
SMART Domains Protein: ENSMUSP00000040802
Gene: ENSMUSG00000035439
AA Change: W360*

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
coiled coil region 164 201 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110071
AA Change: W359*
SMART Domains Protein: ENSMUSP00000105698
Gene: ENSMUSG00000035439
AA Change: W359*

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
coiled coil region 163 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123495
SMART Domains Protein: ENSMUSP00000123517
Gene: ENSMUSG00000035439

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157039
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HAUS8 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]; Uehara et al., 2009 [PubMed 19369198]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Haus8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Haus8 APN 8 71255645 critical splice donor site probably null
IGL01298:Haus8 APN 8 71253113 missense probably damaging 1.00
IGL01455:Haus8 APN 8 71253231 missense probably benign 0.00
IGL02034:Haus8 APN 8 71255558 missense probably damaging 1.00
IGL02112:Haus8 APN 8 71255561 missense probably damaging 1.00
IGL02188:Haus8 APN 8 71257415 missense probably damaging 1.00
IGL02871:Haus8 APN 8 71256494 missense probably benign 0.00
IGL02939:Haus8 APN 8 71255717 splice site probably benign
R0486:Haus8 UTSW 8 71256537 missense probably damaging 1.00
R0486:Haus8 UTSW 8 71256538 missense probably benign 0.01
R0648:Haus8 UTSW 8 71256530 missense probably damaging 1.00
R1848:Haus8 UTSW 8 71256123 intron probably benign
R2327:Haus8 UTSW 8 71255645 critical splice donor site probably null
R4575:Haus8 UTSW 8 71263092 missense probably damaging 0.99
R5294:Haus8 UTSW 8 71255710 missense unknown
R7231:Haus8 UTSW 8 71253137 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCCTTCGGTCCACAAGG -3'
(R):5'- CTCACTTCCAAAGACACTTAGGG -3'

Sequencing Primer
(F):5'- CTTCGGTCCACAAGGAGGAG -3'
(R):5'- GAGTTCACTCTCCAGGACTGACATG -3'
Posted On2018-05-24