Incidental Mutation 'R6424:Katnb1'
ID518266
Institutional Source Beutler Lab
Gene Symbol Katnb1
Ensembl Gene ENSMUSG00000031787
Gene Namekatanin p80 (WD40-containing) subunit B 1
Synonyms2410003J24Rik, KAT
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95081186-95103149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95093516 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 97 (I97N)
Ref Sequence ENSEMBL: ENSMUSP00000034239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000212968]
Predicted Effect probably damaging
Transcript: ENSMUST00000034239
AA Change: I97N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787
AA Change: I97N

DomainStartEndE-ValueType
WD40 9 49 2.61e-3 SMART
WD40 52 91 2.45e-8 SMART
WD40 94 133 3.58e-10 SMART
WD40 136 175 7.49e-13 SMART
WD40 178 217 5.14e-11 SMART
WD40 220 258 1.14e-3 SMART
low complexity region 354 373 N/A INTRINSIC
low complexity region 396 412 N/A INTRINSIC
Pfam:Katanin_con80 496 654 8.2e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212895
Predicted Effect probably benign
Transcript: ENSMUST00000212968
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit embryonic lethality, small embryo, brain and limb bud size, variable eye defects, holoprosencephaly, and thin cerebral cortex with fewer cortical progenitors and post-mitotic neurons. Mutant MEFs form multiple centrioles, multipolar spindles, and supernumerary primary cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Katnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Katnb1 APN 8 95098159 missense probably damaging 1.00
IGL02263:Katnb1 APN 8 95090075 missense probably damaging 1.00
IGL02896:Katnb1 APN 8 95096028 unclassified probably benign
H8562:Katnb1 UTSW 8 95095510 unclassified probably benign
R0139:Katnb1 UTSW 8 95098422 missense possibly damaging 0.90
R0418:Katnb1 UTSW 8 95095658 missense possibly damaging 0.92
R0503:Katnb1 UTSW 8 95095174 missense probably damaging 0.96
R1405:Katnb1 UTSW 8 95098173 missense probably damaging 1.00
R1405:Katnb1 UTSW 8 95098173 missense probably damaging 1.00
R3960:Katnb1 UTSW 8 95087297 missense possibly damaging 0.48
R4866:Katnb1 UTSW 8 95097504 missense possibly damaging 0.78
R4930:Katnb1 UTSW 8 95097294 splice site probably null
R5160:Katnb1 UTSW 8 95095470 missense probably benign 0.01
R5184:Katnb1 UTSW 8 95097980 missense possibly damaging 0.80
R5333:Katnb1 UTSW 8 95095606 missense possibly damaging 0.95
R5529:Katnb1 UTSW 8 95097672 missense probably damaging 0.99
R5848:Katnb1 UTSW 8 95098712 missense probably benign 0.09
R6478:Katnb1 UTSW 8 95095456 missense possibly damaging 0.57
R6785:Katnb1 UTSW 8 95095642 missense probably benign 0.04
R7009:Katnb1 UTSW 8 95098384 missense probably damaging 0.99
R7174:Katnb1 UTSW 8 95097441 missense probably benign 0.00
R7253:Katnb1 UTSW 8 95095497 nonsense probably null
R7486:Katnb1 UTSW 8 95098729 missense probably damaging 1.00
R7718:Katnb1 UTSW 8 95095208 missense possibly damaging 0.78
R7996:Katnb1 UTSW 8 95098015 missense possibly damaging 0.95
R8108:Katnb1 UTSW 8 95093945 missense possibly damaging 0.94
R8163:Katnb1 UTSW 8 95096386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTGATTGATGCTGCCCG -3'
(R):5'- TAAGGATGTTGCCACGAGGG -3'

Sequencing Primer
(F):5'- TGGTACACACAGGCTACGG -3'
(R):5'- TTGCCACGAGGGGAAGATTCC -3'
Posted On2018-05-24