Incidental Mutation 'R6424:Shpk'
ID518269
Institutional Source Beutler Lab
Gene Symbol Shpk
Ensembl Gene ENSMUSG00000005951
Gene Namesedoheptulokinase
Synonyms4930431K22Rik, Carkl
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73199460-73224511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73213492 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 156 (I156F)
Ref Sequence ENSEMBL: ENSMUSP00000006105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006105] [ENSMUST00000131927]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006105
AA Change: I156F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000006105
Gene: ENSMUSG00000005951
AA Change: I156F

DomainStartEndE-ValueType
Pfam:FGGY_N 6 264 3.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131927
SMART Domains Protein: ENSMUSP00000123639
Gene: ENSMUSG00000005951

DomainStartEndE-ValueType
Pfam:FGGY_N 6 109 3.7e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has weak homology to several carbohydrate kinases, a class of proteins involved in the phosphorylation of sugars as they enter a cell, inhibiting return across the cell membrane. Sequence variation between this novel gene and known carbohydrate kinases suggests the possibility of a different substrate, cofactor or changes in kinetic properties distinguishing it from other carbohydrate kinases. The gene resides in a region commonly deleted in cystinosis patients, suggesting a role as a modifier for the cystinosis phenotype. The genomic region is also rich in Alu repetitive sequences, frequently involved in chromosomal rearrangements. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Shpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Shpk APN 11 73203995 missense probably damaging 1.00
IGL03411:Shpk APN 11 73215035 missense probably benign 0.25
R0125:Shpk UTSW 11 73214222 splice site probably benign
R0826:Shpk UTSW 11 73204031 missense probably damaging 1.00
R1055:Shpk UTSW 11 73215119 missense probably benign
R1670:Shpk UTSW 11 73222931 missense probably benign 0.00
R2077:Shpk UTSW 11 73203959 missense probably damaging 1.00
R2263:Shpk UTSW 11 73206493 critical splice donor site probably benign
R5281:Shpk UTSW 11 73215120 missense probably benign 0.06
R5443:Shpk UTSW 11 73222781 missense possibly damaging 0.94
R5461:Shpk UTSW 11 73199535 missense probably benign 0.08
R6063:Shpk UTSW 11 73213444 nonsense probably null
R7150:Shpk UTSW 11 73213489 missense probably damaging 0.99
R7176:Shpk UTSW 11 73222988 missense probably benign 0.05
R7255:Shpk UTSW 11 73199660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAGGTTCAAGGATGTGCC -3'
(R):5'- GACCAAATCTGAACCTTGTAACTCC -3'

Sequencing Primer
(F):5'- GTGCCTATACACACTCAGTACTG -3'
(R):5'- TGTAACTCCACCTTGCACCAGG -3'
Posted On2018-05-24