Incidental Mutation 'R6424:Insm2'
ID518271
Institutional Source Beutler Lab
Gene Symbol Insm2
Ensembl Gene ENSMUSG00000045440
Gene Nameinsulinoma-associated 2
Synonymsmlt 1
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location55599427-55602086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55600082 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 204 (I204F)
Ref Sequence ENSEMBL: ENSMUSP00000061046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051857] [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect probably damaging
Transcript: ENSMUST00000051857
AA Change: I204F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061046
Gene: ENSMUSG00000045440
AA Change: I204F

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
low complexity region 61 78 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 119 136 N/A INTRINSIC
ZnF_C2H2 203 223 1.98e2 SMART
ZnF_C2H2 231 253 7.15e-2 SMART
low complexity region 341 349 N/A INTRINSIC
ZnF_C2H2 354 376 1.2e-3 SMART
ZnF_C2H2 398 420 1.02e1 SMART
low complexity region 433 448 N/A INTRINSIC
ZnF_C2H2 452 475 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085385
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110687
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219432
Predicted Effect probably benign
Transcript: ENSMUST00000219451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219516
Predicted Effect probably benign
Transcript: ENSMUST00000220367
Predicted Effect probably benign
Transcript: ENSMUST00000226244
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Insm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
hawaii UTSW 12 55599836 nonsense probably null
R0646:Insm2 UTSW 12 55600440 missense probably benign 0.19
R1166:Insm2 UTSW 12 55600496 missense probably benign
R2508:Insm2 UTSW 12 55600311 missense probably benign 0.00
R3978:Insm2 UTSW 12 55600838 missense probably benign 0.00
R4716:Insm2 UTSW 12 55600892 missense possibly damaging 0.93
R4884:Insm2 UTSW 12 55599761 missense probably damaging 1.00
R5154:Insm2 UTSW 12 55600197 missense probably damaging 1.00
R6067:Insm2 UTSW 12 55600014 missense probably damaging 1.00
R6078:Insm2 UTSW 12 55600014 missense probably damaging 1.00
R6138:Insm2 UTSW 12 55600014 missense probably damaging 1.00
R6969:Insm2 UTSW 12 55600178 missense probably damaging 1.00
R7069:Insm2 UTSW 12 55599836 nonsense probably null
R7117:Insm2 UTSW 12 55600572 missense probably damaging 1.00
R7252:Insm2 UTSW 12 55600520 missense probably benign 0.00
R7289:Insm2 UTSW 12 55600544 missense probably damaging 0.99
R7537:Insm2 UTSW 12 55599518 missense possibly damaging 0.95
R7831:Insm2 UTSW 12 55600538 missense probably damaging 1.00
R7914:Insm2 UTSW 12 55600538 missense probably damaging 1.00
U15987:Insm2 UTSW 12 55600014 missense probably damaging 1.00
Z1088:Insm2 UTSW 12 55599797 missense probably damaging 1.00
Z1177:Insm2 UTSW 12 55600356 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCTCTGCGGAGTCCTTC -3'
(R):5'- CGGGTACACTAGAGCCTGTAGG -3'

Sequencing Primer
(F):5'- AGGAGTTGGTACCGCCG -3'
(R):5'- GAGGTTTACTCGCGGCG -3'
Posted On2018-05-24