Incidental Mutation 'R6424:Vmn1r223'
ID518272
Institutional Source Beutler Lab
Gene Symbol Vmn1r223
Ensembl Gene ENSMUSG00000069280
Gene Namevomeronasal 1 receptor 223
SynonymsGm11330
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location23249238-23250323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23250175 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 313 (I313N)
Ref Sequence ENSEMBL: ENSMUSP00000089312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091719]
Predicted Effect probably damaging
Transcript: ENSMUST00000091719
AA Change: I313N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089312
Gene: ENSMUSG00000069280
AA Change: I313N

DomainStartEndE-ValueType
low complexity region 46 59 N/A INTRINSIC
Pfam:TAS2R 63 355 6.6e-10 PFAM
Pfam:V1R 94 357 2.1e-39 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Other mutations in Vmn1r223
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Vmn1r223 APN 13 23250084 missense probably damaging 1.00
IGL01016:Vmn1r223 APN 13 23250067 missense probably damaging 1.00
IGL01353:Vmn1r223 APN 13 23249256 missense unknown
IGL01941:Vmn1r223 APN 13 23250237 missense possibly damaging 0.94
IGL02976:Vmn1r223 APN 13 23249995 missense probably damaging 1.00
IGL03064:Vmn1r223 APN 13 23249983 missense probably damaging 1.00
IGL03136:Vmn1r223 APN 13 23249763 missense possibly damaging 0.81
PIT4812001:Vmn1r223 UTSW 13 23249890 missense probably damaging 0.99
R1468:Vmn1r223 UTSW 13 23249868 missense possibly damaging 0.81
R1468:Vmn1r223 UTSW 13 23249868 missense possibly damaging 0.81
R1592:Vmn1r223 UTSW 13 23249667 missense possibly damaging 0.57
R1640:Vmn1r223 UTSW 13 23250178 missense probably damaging 1.00
R2116:Vmn1r223 UTSW 13 23249662 missense probably damaging 1.00
R3076:Vmn1r223 UTSW 13 23250165 missense probably benign 0.15
R4229:Vmn1r223 UTSW 13 23249415 missense probably benign 0.08
R4230:Vmn1r223 UTSW 13 23249415 missense probably benign 0.08
R5420:Vmn1r223 UTSW 13 23249505 missense probably benign 0.02
R6412:Vmn1r223 UTSW 13 23249655 missense probably benign 0.05
R6607:Vmn1r223 UTSW 13 23249749 missense probably damaging 1.00
R6944:Vmn1r223 UTSW 13 23249313 missense unknown
R7256:Vmn1r223 UTSW 13 23249866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATTTTCCAGGGTCTCATG -3'
(R):5'- GCCATCCAAGTGTATATAGCTTTAC -3'

Sequencing Primer
(F):5'- TCTCATGGGCTGGAGCAG -3'
(R):5'- TTCCCAGTGATCAGGACA -3'
Posted On2018-05-24