Incidental Mutation 'R6424:Meltf'
ID518274
Institutional Source Beutler Lab
Gene Symbol Meltf
Ensembl Gene ENSMUSG00000022780
Gene Namemelanotransferrin
SynonymsMTf, CD228, melanotransferrin, Mfi2
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location31878810-31899020 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 31880262 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 63 (C63*)
Ref Sequence ENSEMBL: ENSMUSP00000023464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023464]
Predicted Effect probably null
Transcript: ENSMUST00000023464
AA Change: C63*
SMART Domains Protein: ENSMUSP00000023464
Gene: ENSMUSG00000022780
AA Change: C63*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 23 364 2.62e-183 SMART
TR_FER 366 719 4.23e-178 SMART
low complexity region 721 734 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, exhibit no physical defects, and develop normally with no detectable alterations in iron metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Meltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Meltf APN 16 31888985 missense probably damaging 1.00
IGL02942:Meltf APN 16 31890778 nonsense probably null
IGL03340:Meltf APN 16 31892784 missense probably damaging 1.00
R0734:Meltf UTSW 16 31881958 missense probably damaging 0.99
R1023:Meltf UTSW 16 31884960 missense probably damaging 1.00
R1751:Meltf UTSW 16 31883929 missense probably damaging 1.00
R1767:Meltf UTSW 16 31883929 missense probably damaging 1.00
R1851:Meltf UTSW 16 31896577 missense probably benign 0.00
R1900:Meltf UTSW 16 31881969 critical splice donor site probably null
R1993:Meltf UTSW 16 31892622 nonsense probably null
R3423:Meltf UTSW 16 31896525 nonsense probably null
R3425:Meltf UTSW 16 31896525 nonsense probably null
R3804:Meltf UTSW 16 31884998 missense probably benign 0.23
R4724:Meltf UTSW 16 31892505 missense probably benign 0.03
R4976:Meltf UTSW 16 31894714 missense probably benign 0.01
R5007:Meltf UTSW 16 31887562 missense possibly damaging 0.60
R5058:Meltf UTSW 16 31887603 splice site probably null
R5534:Meltf UTSW 16 31890814 critical splice donor site probably null
R5661:Meltf UTSW 16 31881926 missense possibly damaging 0.65
R6028:Meltf UTSW 16 31887476 missense possibly damaging 0.91
R6464:Meltf UTSW 16 31890776 missense probably benign 0.19
R6479:Meltf UTSW 16 31881882 missense probably damaging 1.00
R6525:Meltf UTSW 16 31888899 nonsense probably null
R6629:Meltf UTSW 16 31885076 missense probably damaging 1.00
R6964:Meltf UTSW 16 31880162 missense probably benign 0.41
R7133:Meltf UTSW 16 31892799 missense probably damaging 1.00
R7169:Meltf UTSW 16 31880162 missense probably benign 0.41
R7198:Meltf UTSW 16 31883799 missense possibly damaging 0.61
R7212:Meltf UTSW 16 31890814 critical splice donor site probably null
R7246:Meltf UTSW 16 31894862 missense probably damaging 1.00
R7407:Meltf UTSW 16 31894735 missense probably damaging 1.00
R7424:Meltf UTSW 16 31884946 missense probably damaging 1.00
R7475:Meltf UTSW 16 31881938 missense probably benign 0.12
R7727:Meltf UTSW 16 31883794 missense probably damaging 0.99
R7764:Meltf UTSW 16 31880267 missense probably benign 0.01
X0062:Meltf UTSW 16 31880200 missense probably damaging 1.00
Z1177:Meltf UTSW 16 31880234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACAAGGCTGTGTGTCAG -3'
(R):5'- TCACTGCTAGGGAAACTCAGG -3'

Sequencing Primer
(F):5'- TCAGGGGTTGGCCATCCAG -3'
(R):5'- GGAGATTGTATCACCAACCCTG -3'
Posted On2018-05-24