Incidental Mutation 'R6425:Ube2b'
ID 518300
Institutional Source Beutler Lab
Gene Symbol Ube2b
Ensembl Gene ENSMUSG00000020390
Gene Name ubiquitin-conjugating enzyme E2B
Synonyms Rad6b, HR6B, E2-14k
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.400) question?
Stock # R6425 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 51985497-52000762 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 51991417 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 73 (L73*)
Ref Sequence ENSEMBL: ENSMUSP00000104714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020657] [ENSMUST00000109086]
AlphaFold P63147
Predicted Effect probably null
Transcript: ENSMUST00000020657
AA Change: L73*
SMART Domains Protein: ENSMUSP00000020657
Gene: ENSMUSG00000020390
AA Change: L73*

DomainStartEndE-ValueType
UBCc 7 150 3.01e-72 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109086
AA Change: L73*
SMART Domains Protein: ENSMUSP00000104714
Gene: ENSMUSG00000020390
AA Change: L73*

DomainStartEndE-ValueType
UBCc 7 150 3.01e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Its protein sequence is 100% identical to the mouse, rat, and rabbit homologs, which indicates that this enzyme is highly conserved in eukaryotic evolution. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit male sterility with failure at the stage of postmeiotic condensation of chromatin in spermatids. However, in 10-20% of males there is a nearly complete absence of all germ cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T C 11: 110,329,232 T3A possibly damaging Het
Ash1l A G 3: 88,983,780 T989A probably damaging Het
Atp6v0a2 T A 5: 124,713,130 L459Q probably damaging Het
Atp6v0a4 A T 6: 38,050,511 V788D possibly damaging Het
Auh G A 13: 52,841,044 R162C probably damaging Het
Begain C A 12: 109,033,394 G689C probably damaging Het
Cd300lg T C 11: 102,046,923 F193S probably benign Het
Cenpf T G 1: 189,659,898 N579T probably benign Het
Cfap65 T C 1: 74,927,709 H273R probably benign Het
Col6a6 T C 9: 105,698,865 T2099A probably benign Het
Dock1 A G 7: 135,163,381 K1701E possibly damaging Het
Dtl T C 1: 191,546,623 I376V probably benign Het
F830045P16Rik C A 2: 129,460,580 C364F probably damaging Het
Fancl C T 11: 26,399,680 L63F probably damaging Het
Gli2 A T 1: 118,835,894 L1509* probably null Het
Glyr1 A T 16: 5,036,486 probably null Het
Gm5136 A C 10: 108,699,896 M66R possibly damaging Het
Igkv6-32 A T 6: 70,074,300 M24K probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klhl18 T C 9: 110,446,681 E133G possibly damaging Het
Lgals4 A T 7: 28,834,460 K20* probably null Het
Myo9b A G 8: 71,333,628 D646G probably damaging Het
Pcdhb3 T C 18: 37,302,475 L498P possibly damaging Het
Pcdhgb4 T C 18: 37,721,587 V345A possibly damaging Het
Pdc T C 1: 150,333,372 V202A probably benign Het
Pfas T C 11: 68,991,071 I929M probably benign Het
Plxna1 G T 6: 89,334,665 R953S probably benign Het
Pnpla5 T C 15: 84,122,635 probably null Het
Psmd1 T C 1: 86,070,628 probably null Het
Rbm47 C T 5: 66,022,816 G452S probably damaging Het
Reln G A 5: 21,911,020 Q2997* probably null Het
Rrn3 A G 16: 13,811,601 T594A probably benign Het
Slc25a35 G A 11: 68,968,765 A35T possibly damaging Het
Slc33a1 A G 3: 63,964,063 V43A probably benign Het
Sorcs3 T C 19: 48,764,307 probably null Het
Tbk1 A G 10: 121,563,962 M319T probably benign Het
Tmem132c T A 5: 127,553,265 M622K possibly damaging Het
Tshz1 A T 18: 84,015,563 F240Y probably damaging Het
Vipas39 A G 12: 87,241,289 V449A probably damaging Het
Zfp870 T C 17: 32,883,071 N429S possibly damaging Het
Other mutations in Ube2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ube2b APN 11 51986719 missense probably damaging 1.00
IGL00661:Ube2b APN 11 52000292 critical splice donor site probably null
IGL00843:Ube2b APN 11 51995375 missense probably benign 0.00
IGL02972:Ube2b APN 11 51988682 missense probably damaging 1.00
IGL03339:Ube2b APN 11 51986707 missense probably damaging 1.00
R0390:Ube2b UTSW 11 51988602 splice site probably benign
R1589:Ube2b UTSW 11 51997872 missense probably benign 0.13
R4095:Ube2b UTSW 11 51997827 missense possibly damaging 0.93
R4651:Ube2b UTSW 11 51995372 critical splice donor site probably null
R4653:Ube2b UTSW 11 51995372 critical splice donor site probably null
R5385:Ube2b UTSW 11 51988644 missense probably damaging 1.00
R7596:Ube2b UTSW 11 51986743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTAATTCACACATGGAACCCTG -3'
(R):5'- ATATGCTAAATGAGAGTTCTCGGG -3'

Sequencing Primer
(F):5'- CATGGAACCCTGTTAAGATTCTAGC -3'
(R):5'- TGCTAAATGAGAGTTCTCGGGCTAAC -3'
Posted On 2018-05-24