Incidental Mutation 'R6425:Tshz1'
ID518313
Institutional Source Beutler Lab
Gene Symbol Tshz1
Ensembl Gene ENSMUSG00000046982
Gene Nameteashirt zinc finger family member 1
SynonymsMtsh1, teashirt1, Sdccag33, D18Bwg1409e, Tsh1, NY-CO-33, 5730407I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6425 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location84011627-84086404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84015563 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 240 (F240Y)
Ref Sequence ENSEMBL: ENSMUSP00000089388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060303]
Predicted Effect probably damaging
Transcript: ENSMUST00000060303
AA Change: F240Y

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089388
Gene: ENSMUSG00000046982
AA Change: F240Y

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 153 195 N/A INTRINSIC
ZnF_C2H2 246 270 1.86e0 SMART
ZnF_C2H2 307 331 3.83e-2 SMART
ZnF_C2H2 416 440 5.34e0 SMART
low complexity region 497 515 N/A INTRINSIC
HOX 890 964 4.15e-4 SMART
ZnF_C2H2 976 998 4.34e-1 SMART
ZnF_C2H2 1044 1067 4.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175783
SMART Domains Protein: ENSMUSP00000135640
Gene: ENSMUSG00000046982

DomainStartEndE-ValueType
ZnF_C2H2 43 67 1.7e-4 SMART
ZnF_C2H2 152 176 2.3e-2 SMART
low complexity region 233 251 N/A INTRINSIC
HOX 626 700 2.1e-6 SMART
ZnF_C2H2 712 734 1.9e-3 SMART
ZnF_C2H2 780 803 1.8e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer antigen that was defined by serological analysis of recombinant cDNA expression libraries. The encoded protein is a member of the teashirt C2H2-type zinc-finger protein family and may be involved in transcriptional regulation of developmental processes. Mutations in this gene may be associated with congenital aural atresia syndrome. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele die shortly after birth of respiratory distress, have defects in soft palate formation, have altered axial skeleton and have middle ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T C 11: 110,329,232 T3A possibly damaging Het
Ash1l A G 3: 88,983,780 T989A probably damaging Het
Atp6v0a2 T A 5: 124,713,130 L459Q probably damaging Het
Atp6v0a4 A T 6: 38,050,511 V788D possibly damaging Het
Auh G A 13: 52,841,044 R162C probably damaging Het
Begain C A 12: 109,033,394 G689C probably damaging Het
Cd300lg T C 11: 102,046,923 F193S probably benign Het
Cenpf T G 1: 189,659,898 N579T probably benign Het
Cfap65 T C 1: 74,927,709 H273R probably benign Het
Col6a6 T C 9: 105,698,865 T2099A probably benign Het
Dock1 A G 7: 135,163,381 K1701E possibly damaging Het
Dtl T C 1: 191,546,623 I376V probably benign Het
F830045P16Rik C A 2: 129,460,580 C364F probably damaging Het
Fancl C T 11: 26,399,680 L63F probably damaging Het
Gli2 A T 1: 118,835,894 L1509* probably null Het
Glyr1 A T 16: 5,036,486 probably null Het
Gm5136 A C 10: 108,699,896 M66R possibly damaging Het
Igkv6-32 A T 6: 70,074,300 M24K probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klhl18 T C 9: 110,446,681 E133G possibly damaging Het
Lgals4 A T 7: 28,834,460 K20* probably null Het
Myo9b A G 8: 71,333,628 D646G probably damaging Het
Pcdhb3 T C 18: 37,302,475 L498P possibly damaging Het
Pcdhgb4 T C 18: 37,721,587 V345A possibly damaging Het
Pdc T C 1: 150,333,372 V202A probably benign Het
Pfas T C 11: 68,991,071 I929M probably benign Het
Plxna1 G T 6: 89,334,665 R953S probably benign Het
Pnpla5 T C 15: 84,122,635 probably null Het
Psmd1 T C 1: 86,070,628 probably null Het
Rbm47 C T 5: 66,022,816 G452S probably damaging Het
Reln G A 5: 21,911,020 Q2997* probably null Het
Rrn3 A G 16: 13,811,601 T594A probably benign Het
Slc25a35 G A 11: 68,968,765 A35T possibly damaging Het
Slc33a1 A G 3: 63,964,063 V43A probably benign Het
Sorcs3 T C 19: 48,764,307 probably null Het
Tbk1 A G 10: 121,563,962 M319T probably benign Het
Tmem132c T A 5: 127,553,265 M622K possibly damaging Het
Ube2b A T 11: 51,991,417 L73* probably null Het
Vipas39 A G 12: 87,241,289 V449A probably damaging Het
Zfp870 T C 17: 32,883,071 N429S possibly damaging Het
Other mutations in Tshz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Tshz1 APN 18 84013509 missense possibly damaging 0.94
IGL02934:Tshz1 APN 18 84013090 missense probably damaging 1.00
ANU18:Tshz1 UTSW 18 84014661 missense probably damaging 1.00
PIT4810001:Tshz1 UTSW 18 84013250 missense possibly damaging 0.85
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0364:Tshz1 UTSW 18 84016124 missense probably benign 0.31
R0391:Tshz1 UTSW 18 84016049 missense possibly damaging 0.93
R0515:Tshz1 UTSW 18 84015965 missense probably benign
R0942:Tshz1 UTSW 18 84013053 missense probably damaging 0.99
R0943:Tshz1 UTSW 18 84015231 missense probably benign 0.04
R1472:Tshz1 UTSW 18 84013805 missense possibly damaging 0.93
R1895:Tshz1 UTSW 18 84013433 missense probably damaging 1.00
R2022:Tshz1 UTSW 18 84013862 missense probably damaging 0.98
R2860:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R2861:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R4027:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4028:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4030:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4031:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4119:Tshz1 UTSW 18 84014189 missense probably benign 0.00
R4233:Tshz1 UTSW 18 84016195 missense probably benign 0.00
R4573:Tshz1 UTSW 18 84015082 missense probably damaging 1.00
R4604:Tshz1 UTSW 18 84013374 missense probably damaging 1.00
R4960:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R5085:Tshz1 UTSW 18 84013928 missense probably benign 0.01
R5124:Tshz1 UTSW 18 84015467 missense probably damaging 1.00
R5150:Tshz1 UTSW 18 84013215 nonsense probably null
R5357:Tshz1 UTSW 18 84015080 missense probably damaging 1.00
R5530:Tshz1 UTSW 18 84013268 missense probably damaging 1.00
R5718:Tshz1 UTSW 18 84014524 missense probably damaging 1.00
R5750:Tshz1 UTSW 18 84013961 missense possibly damaging 0.93
R5778:Tshz1 UTSW 18 84015680 missense probably damaging 1.00
R6052:Tshz1 UTSW 18 84014069 missense probably damaging 1.00
R6279:Tshz1 UTSW 18 84015311 missense probably damaging 1.00
R6393:Tshz1 UTSW 18 84013220 missense probably damaging 1.00
R6407:Tshz1 UTSW 18 84015966 missense possibly damaging 0.55
R6998:Tshz1 UTSW 18 84015841 missense probably benign 0.00
R7165:Tshz1 UTSW 18 84015927 missense probably damaging 1.00
R7233:Tshz1 UTSW 18 84014819 missense possibly damaging 0.63
R7330:Tshz1 UTSW 18 84014831 missense probably damaging 0.96
R7491:Tshz1 UTSW 18 84015641 missense probably damaging 1.00
R7579:Tshz1 UTSW 18 84014665 nonsense probably null
R7592:Tshz1 UTSW 18 84014048 missense probably damaging 1.00
R7659:Tshz1 UTSW 18 84016075 missense probably damaging 0.97
R7702:Tshz1 UTSW 18 84014336 missense probably damaging 1.00
R7844:Tshz1 UTSW 18 84014171 missense probably benign 0.00
R7908:Tshz1 UTSW 18 84014607 nonsense probably null
R7927:Tshz1 UTSW 18 84014171 missense probably benign 0.00
R7989:Tshz1 UTSW 18 84014607 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATACACTTCAGCACCTTCTGGG -3'
(R):5'- AGGAGAGTTCCACACCTACC -3'

Sequencing Primer
(F):5'- AGCACCTTCTGGGCGTCC -3'
(R):5'- GCCTCCTACTAGTACCGCCAG -3'
Posted On2018-05-24