Incidental Mutation 'R6426:Cst3'
ID518317
Institutional Source Beutler Lab
Gene Symbol Cst3
Ensembl Gene ENSMUSG00000027447
Gene Namecystatin C
SynonymsCysC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6426 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location148871722-148875692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 148871997 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 129 (T129K)
Ref Sequence ENSEMBL: ENSMUSP00000028938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028938] [ENSMUST00000144845]
Predicted Effect probably benign
Transcript: ENSMUST00000028938
AA Change: T129K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028938
Gene: ENSMUSG00000027447
AA Change: T129K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CY 28 138 8.44e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144845
SMART Domains Protein: ENSMUSP00000117672
Gene: ENSMUSG00000027447

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CY 28 102 5.39e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149691
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: The protein encoded by this gene is a cysteine protease inhibitor involved in neurodegenerative and cardiovascular processes. The encoded protein inhibits aggregation of beta-amyloid protein, a hallmark of Alzheimer's disease, so it may be useful as a therapeutic. This protein also may be a biomarker for atherosclerosis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit increased metastatic potential and decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Adcyap1r1 T G 6: 55,494,187 L365R probably damaging Het
Adgre4 A G 17: 55,802,196 N401S probably benign Het
Adgrl3 A T 5: 81,726,870 S1073C probably damaging Het
Bicral G A 17: 46,830,079 P26S probably benign Het
Cyp26a1 T C 19: 37,699,305 M287T probably benign Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dmxl1 T C 18: 49,864,578 V611A probably damaging Het
Fam149a C A 8: 45,381,574 A63S probably benign Het
Fam160b1 T G 19: 57,383,178 L574R probably damaging Het
Foxred2 C G 15: 77,953,308 A243P probably damaging Het
Gm3604 A T 13: 62,369,622 D307E probably damaging Het
Lca5 G A 9: 83,395,654 Q546* probably null Het
Mfsd4b1 T C 10: 40,006,077 T71A possibly damaging Het
Olfr76 A G 19: 12,119,848 V288A probably benign Het
Onecut1 A G 9: 74,862,349 H18R probably damaging Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Pcsk5 G T 19: 17,617,729 Q414K probably damaging Het
Ppp4r2 T C 6: 100,852,597 Y77H probably damaging Het
Prr19 A G 7: 25,303,837 D292G probably damaging Het
Pum1 G A 4: 130,753,972 R464H probably damaging Het
Rhoq G T 17: 86,995,014 R126L probably damaging Het
Sdhb A G 4: 140,973,718 K162E probably benign Het
Sema3d G A 5: 12,563,264 G436E probably damaging Het
Sf3b1 A T 1: 54,999,655 M823K probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Syne2 G T 12: 75,923,083 E977D probably null Het
Tns2 A T 15: 102,107,037 M125L possibly damaging Het
Ttn T A 2: 76,711,969 K31812* probably null Het
Ube4b G A 4: 149,425,996 probably benign Het
Vmn2r91 G A 17: 18,135,603 probably null Het
Zbtb49 G A 5: 38,203,087 probably null Het
Zswim8 T A 14: 20,718,526 S1035T probably damaging Het
Other mutations in Cst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Cst3 APN 2 148872877 nonsense probably null
IGL02502:Cst3 APN 2 148875145 splice site probably benign
R0255:Cst3 UTSW 2 148875169 missense probably damaging 1.00
R3054:Cst3 UTSW 2 148872031 missense probably damaging 1.00
R5978:Cst3 UTSW 2 148872821 missense probably benign 0.00
R5978:Cst3 UTSW 2 148872822 missense probably benign 0.00
R7885:Cst3 UTSW 2 148872821 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGTTCAGATGTGCAGAACCTG -3'
(R):5'- TAGGGATGAACAGACCCTGC -3'

Sequencing Primer
(F):5'- CAGAACCTGCCTGCAGC -3'
(R):5'- GATGAACAGACCCTGCTAAGTGTC -3'
Posted On2018-05-24