Incidental Mutation 'R6426:Onecut1'
ID518328
Institutional Source Beutler Lab
Gene Symbol Onecut1
Ensembl Gene ENSMUSG00000043013
Gene Nameone cut domain, family member 1
SynonymsHNF6, Oc1, OC-1, D9Ertd423e, Hfh12, Hnf6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock #R6426 (G1)
Quality Score157.22
Status Validated
Chromosome9
Chromosomal Location74861921-74891781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74862349 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 18 (H18R)
Ref Sequence ENSEMBL: ENSMUSP00000058020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056006]
PDB Structure
Solution structure of HNF-6 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000056006
AA Change: H18R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058020
Gene: ENSMUSG00000043013
AA Change: H18R

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
low complexity region 174 189 N/A INTRINSIC
low complexity region 248 253 N/A INTRINSIC
CUT 284 369 2.04e-43 SMART
HOX 385 447 1.33e-13 SMART
low complexity region 448 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161862
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cut homeobox family of transcription factors. Expression of the encoded protein is enriched in the liver, where it stimulates transcription of liver-expressed genes, and antagonizes glucocorticoid-stimulated gene transcription. This gene may influence a variety of cellular processes including glucose metabolism, cell cycle regulation, and it may also be associated with cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mutation of this gene results in partial postnatal lethality, billiary tract, pancreas, and islet of Langerhans abnormalities, growth retardation, and glucose and insulin metabolism defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Adcyap1r1 T G 6: 55,494,187 L365R probably damaging Het
Adgre4 A G 17: 55,802,196 N401S probably benign Het
Adgrl3 A T 5: 81,726,870 S1073C probably damaging Het
Bicral G A 17: 46,830,079 P26S probably benign Het
Cst3 G T 2: 148,871,997 T129K probably benign Het
Cyp26a1 T C 19: 37,699,305 M287T probably benign Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dmxl1 T C 18: 49,864,578 V611A probably damaging Het
Fam149a C A 8: 45,381,574 A63S probably benign Het
Fam160b1 T G 19: 57,383,178 L574R probably damaging Het
Foxred2 C G 15: 77,953,308 A243P probably damaging Het
Gm3604 A T 13: 62,369,622 D307E probably damaging Het
Lca5 G A 9: 83,395,654 Q546* probably null Het
Mfsd4b1 T C 10: 40,006,077 T71A possibly damaging Het
Olfr76 A G 19: 12,119,848 V288A probably benign Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Pcsk5 G T 19: 17,617,729 Q414K probably damaging Het
Ppp4r2 T C 6: 100,852,597 Y77H probably damaging Het
Prr19 A G 7: 25,303,837 D292G probably damaging Het
Pum1 G A 4: 130,753,972 R464H probably damaging Het
Rhoq G T 17: 86,995,014 R126L probably damaging Het
Sdhb A G 4: 140,973,718 K162E probably benign Het
Sema3d G A 5: 12,563,264 G436E probably damaging Het
Sf3b1 A T 1: 54,999,655 M823K probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Syne2 G T 12: 75,923,083 E977D probably null Het
Tns2 A T 15: 102,107,037 M125L possibly damaging Het
Ttn T A 2: 76,711,969 K31812* probably null Het
Ube4b G A 4: 149,425,996 probably benign Het
Vmn2r91 G A 17: 18,135,603 probably null Het
Zbtb49 G A 5: 38,203,087 probably null Het
Zswim8 T A 14: 20,718,526 S1035T probably damaging Het
Other mutations in Onecut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Onecut1 APN 9 74889533 missense possibly damaging 0.51
IGL02704:Onecut1 APN 9 74863030 missense probably damaging 1.00
R1601:Onecut1 UTSW 9 74862691 missense probably benign 0.26
R5407:Onecut1 UTSW 9 74889456 missense probably damaging 1.00
R5468:Onecut1 UTSW 9 74863332 missense probably damaging 0.96
R5785:Onecut1 UTSW 9 74863392 missense probably damaging 1.00
R5828:Onecut1 UTSW 9 74862760 missense probably benign 0.05
R5928:Onecut1 UTSW 9 74862784 missense probably benign 0.00
R6495:Onecut1 UTSW 9 74863215 missense probably damaging 1.00
R7506:Onecut1 UTSW 9 74863240 missense possibly damaging 0.73
X0004:Onecut1 UTSW 9 74862682 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATCCCCACAGTGAGAGGAAG -3'
(R):5'- AGTTTCACAGGCCATGGTC -3'

Sequencing Primer
(F):5'- AGAAAGGCCACAGTCGC -3'
(R):5'- AGCCAAGCTGTGCTCAG -3'
Posted On2018-05-24