Incidental Mutation 'R6426:Mfsd4b1'
ID518329
Institutional Source Beutler Lab
Gene Symbol Mfsd4b1
Ensembl Gene ENSMUSG00000038522
Gene Namemajor facilitator superfamily domain containing 4B1
SynonymsAI317395
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6426 (G1)
Quality Score174.009
Status Validated
Chromosome10
Chromosomal Location40001575-40025268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40006077 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 71 (T71A)
Ref Sequence ENSEMBL: ENSMUSP00000128324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163705]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163705
AA Change: T71A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128324
Gene: ENSMUSG00000038522
AA Change: T71A

DomainStartEndE-ValueType
Pfam:MFS_1 1 369 1.9e-15 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214611
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Adcyap1r1 T G 6: 55,494,187 L365R probably damaging Het
Adgre4 A G 17: 55,802,196 N401S probably benign Het
Adgrl3 A T 5: 81,726,870 S1073C probably damaging Het
Bicral G A 17: 46,830,079 P26S probably benign Het
Cst3 G T 2: 148,871,997 T129K probably benign Het
Cyp26a1 T C 19: 37,699,305 M287T probably benign Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dmxl1 T C 18: 49,864,578 V611A probably damaging Het
Fam149a C A 8: 45,381,574 A63S probably benign Het
Fam160b1 T G 19: 57,383,178 L574R probably damaging Het
Foxred2 C G 15: 77,953,308 A243P probably damaging Het
Gm3604 A T 13: 62,369,622 D307E probably damaging Het
Lca5 G A 9: 83,395,654 Q546* probably null Het
Olfr76 A G 19: 12,119,848 V288A probably benign Het
Onecut1 A G 9: 74,862,349 H18R probably damaging Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Pcsk5 G T 19: 17,617,729 Q414K probably damaging Het
Ppp4r2 T C 6: 100,852,597 Y77H probably damaging Het
Prr19 A G 7: 25,303,837 D292G probably damaging Het
Pum1 G A 4: 130,753,972 R464H probably damaging Het
Rhoq G T 17: 86,995,014 R126L probably damaging Het
Sdhb A G 4: 140,973,718 K162E probably benign Het
Sema3d G A 5: 12,563,264 G436E probably damaging Het
Sf3b1 A T 1: 54,999,655 M823K probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Syne2 G T 12: 75,923,083 E977D probably null Het
Tns2 A T 15: 102,107,037 M125L possibly damaging Het
Ttn T A 2: 76,711,969 K31812* probably null Het
Ube4b G A 4: 149,425,996 probably benign Het
Vmn2r91 G A 17: 18,135,603 probably null Het
Zbtb49 G A 5: 38,203,087 probably null Het
Zswim8 T A 14: 20,718,526 S1035T probably damaging Het
Other mutations in Mfsd4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Mfsd4b1 APN 10 40003119 missense probably benign 0.16
IGL03356:Mfsd4b1 APN 10 40002831 missense probably damaging 0.97
R1467:Mfsd4b1 UTSW 10 40002635 missense possibly damaging 0.93
R1467:Mfsd4b1 UTSW 10 40002635 missense possibly damaging 0.93
R1770:Mfsd4b1 UTSW 10 40003227 missense probably damaging 0.99
R1930:Mfsd4b1 UTSW 10 40006074 missense probably benign 0.01
R2122:Mfsd4b1 UTSW 10 40002651 missense possibly damaging 0.91
R2290:Mfsd4b1 UTSW 10 40003331 missense probably damaging 0.99
R3508:Mfsd4b1 UTSW 10 40002719 missense probably benign 0.15
R4469:Mfsd4b1 UTSW 10 40012095 intron probably benign
R4594:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
R5300:Mfsd4b1 UTSW 10 40003031 missense probably benign
R6250:Mfsd4b1 UTSW 10 40003110 missense possibly damaging 0.92
R7061:Mfsd4b1 UTSW 10 40003386 missense possibly damaging 0.83
R7595:Mfsd4b1 UTSW 10 40003225 nonsense probably null
R7734:Mfsd4b1 UTSW 10 40007378 missense probably damaging 0.98
R7737:Mfsd4b1 UTSW 10 40003278 missense probably damaging 0.97
R7852:Mfsd4b1 UTSW 10 40003415 missense probably benign 0.23
R7893:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
R7935:Mfsd4b1 UTSW 10 40003415 missense probably benign 0.23
R7976:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
X0063:Mfsd4b1 UTSW 10 40007307 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCAAGGACAGTCGACACC -3'
(R):5'- CTGCAACTCTGTGTTAACTCAG -3'

Sequencing Primer
(F):5'- AGTCGACACCACCCGCTG -3'
(R):5'- TTCCACTCCTGAGTTACG -3'
Posted On2018-05-24