Incidental Mutation 'R6426:Abat'
ID518336
Institutional Source Beutler Lab
Gene Symbol Abat
Ensembl Gene ENSMUSG00000057880
Gene Name4-aminobutyrate aminotransferase
SynonymsGABA-T, 9630038C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6426 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location8513429-8621568 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 8602436 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065987] [ENSMUST00000115838] [ENSMUST00000115839] [ENSMUST00000138987]
Predicted Effect probably benign
Transcript: ENSMUST00000065987
SMART Domains Protein: ENSMUSP00000063548
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 65 496 1.7e-136 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000115838
AA Change: H200Y
SMART Domains Protein: ENSMUSP00000111504
Gene: ENSMUSG00000057880
AA Change: H200Y

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 186 5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115839
SMART Domains Protein: ENSMUSP00000111505
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 323 3.2e-64 PFAM
Pfam:Aminotran_3 317 390 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138987
SMART Domains Protein: ENSMUSP00000116686
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 53 232 1.9e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144444
AA Change: H104Y
SMART Domains Protein: ENSMUSP00000121881
Gene: ENSMUSG00000057880
AA Change: H104Y

DomainStartEndE-ValueType
Pfam:Aminotran_3 3 93 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: The encoded gene product is responsible for catabolism of gamma-aminobutyric acid (GABA), a mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. Deficiency of this encoded protein includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 T G 6: 55,494,187 L365R probably damaging Het
Adgre4 A G 17: 55,802,196 N401S probably benign Het
Adgrl3 A T 5: 81,726,870 S1073C probably damaging Het
Bicral G A 17: 46,830,079 P26S probably benign Het
Cst3 G T 2: 148,871,997 T129K probably benign Het
Cyp26a1 T C 19: 37,699,305 M287T probably benign Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dmxl1 T C 18: 49,864,578 V611A probably damaging Het
Fam149a C A 8: 45,381,574 A63S probably benign Het
Fam160b1 T G 19: 57,383,178 L574R probably damaging Het
Foxred2 C G 15: 77,953,308 A243P probably damaging Het
Gm3604 A T 13: 62,369,622 D307E probably damaging Het
Lca5 G A 9: 83,395,654 Q546* probably null Het
Mfsd4b1 T C 10: 40,006,077 T71A possibly damaging Het
Olfr76 A G 19: 12,119,848 V288A probably benign Het
Onecut1 A G 9: 74,862,349 H18R probably damaging Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Pcsk5 G T 19: 17,617,729 Q414K probably damaging Het
Ppp4r2 T C 6: 100,852,597 Y77H probably damaging Het
Prr19 A G 7: 25,303,837 D292G probably damaging Het
Pum1 G A 4: 130,753,972 R464H probably damaging Het
Rhoq G T 17: 86,995,014 R126L probably damaging Het
Sdhb A G 4: 140,973,718 K162E probably benign Het
Sema3d G A 5: 12,563,264 G436E probably damaging Het
Sf3b1 A T 1: 54,999,655 M823K probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Syne2 G T 12: 75,923,083 E977D probably null Het
Tns2 A T 15: 102,107,037 M125L possibly damaging Het
Ttn T A 2: 76,711,969 K31812* probably null Het
Ube4b G A 4: 149,425,996 probably benign Het
Vmn2r91 G A 17: 18,135,603 probably null Het
Zbtb49 G A 5: 38,203,087 probably null Het
Zswim8 T A 14: 20,718,526 S1035T probably damaging Het
Other mutations in Abat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Abat APN 16 8614046 missense probably benign 0.04
IGL01642:Abat APN 16 8600919 missense possibly damaging 0.81
IGL02024:Abat APN 16 8611136 missense probably damaging 1.00
IGL02071:Abat APN 16 8582812 missense probably damaging 1.00
R2853:Abat UTSW 16 8600968 missense probably damaging 1.00
R4839:Abat UTSW 16 8583648 intron probably benign
R4895:Abat UTSW 16 8615962 missense probably benign 0.00
R5378:Abat UTSW 16 8578277 missense probably benign 0.00
R5804:Abat UTSW 16 8578236 nonsense probably null
R6012:Abat UTSW 16 8582827 missense probably damaging 1.00
R6113:Abat UTSW 16 8572900 missense probably benign 0.01
R6122:Abat UTSW 16 8605550 missense probably benign 0.01
R6190:Abat UTSW 16 8605608 missense probably damaging 1.00
R6328:Abat UTSW 16 8602436 intron probably benign
R6382:Abat UTSW 16 8600986 missense probably benign 0.11
R6427:Abat UTSW 16 8602436 intron probably benign
R6428:Abat UTSW 16 8602436 intron probably benign
R6738:Abat UTSW 16 8602436 intron probably benign
R7009:Abat UTSW 16 8602367 missense probably benign 0.05
R7019:Abat UTSW 16 8618531 nonsense probably null
R7310:Abat UTSW 16 8605593 missense probably null 0.01
R7499:Abat UTSW 16 8603754 critical splice donor site probably null
R8122:Abat UTSW 16 8615897 missense probably damaging 1.00
R8138:Abat UTSW 16 8600965 missense probably benign 0.05
Z1177:Abat UTSW 16 8603753 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGTACTCATCCTGGACCCCTC -3'
(R):5'- AGTCAGGGTTTGTTGAAATGGAAC -3'

Sequencing Primer
(F):5'- ATCCTGGACCCCTCTGCAG -3'
(R):5'- CTGATCAGGACTGCCTAGGTATAC -3'
Posted On2018-05-24