Incidental Mutation 'R6426:Vmn2r91'
ID518337
Institutional Source Beutler Lab
Gene Symbol Vmn2r91
Ensembl Gene ENSMUSG00000091206
Gene Namevomeronasal 2, receptor 91
SynonymsEG665210
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6426 (G1)
Quality Score172.009
Status Validated
Chromosome17
Chromosomal Location18085057-18136643 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 18135603 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172359]
Predicted Effect probably null
Transcript: ENSMUST00000172359
SMART Domains Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 462 2.2e-38 PFAM
Pfam:NCD3G 510 564 6.7e-20 PFAM
Pfam:7tm_3 597 832 2.1e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Adcyap1r1 T G 6: 55,494,187 L365R probably damaging Het
Adgre4 A G 17: 55,802,196 N401S probably benign Het
Adgrl3 A T 5: 81,726,870 S1073C probably damaging Het
Bicral G A 17: 46,830,079 P26S probably benign Het
Cst3 G T 2: 148,871,997 T129K probably benign Het
Cyp26a1 T C 19: 37,699,305 M287T probably benign Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dmxl1 T C 18: 49,864,578 V611A probably damaging Het
Fam149a C A 8: 45,381,574 A63S probably benign Het
Fam160b1 T G 19: 57,383,178 L574R probably damaging Het
Foxred2 C G 15: 77,953,308 A243P probably damaging Het
Gm3604 A T 13: 62,369,622 D307E probably damaging Het
Lca5 G A 9: 83,395,654 Q546* probably null Het
Mfsd4b1 T C 10: 40,006,077 T71A possibly damaging Het
Olfr76 A G 19: 12,119,848 V288A probably benign Het
Onecut1 A G 9: 74,862,349 H18R probably damaging Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Pcsk5 G T 19: 17,617,729 Q414K probably damaging Het
Ppp4r2 T C 6: 100,852,597 Y77H probably damaging Het
Prr19 A G 7: 25,303,837 D292G probably damaging Het
Pum1 G A 4: 130,753,972 R464H probably damaging Het
Rhoq G T 17: 86,995,014 R126L probably damaging Het
Sdhb A G 4: 140,973,718 K162E probably benign Het
Sema3d G A 5: 12,563,264 G436E probably damaging Het
Sf3b1 A T 1: 54,999,655 M823K probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Syne2 G T 12: 75,923,083 E977D probably null Het
Tns2 A T 15: 102,107,037 M125L possibly damaging Het
Ttn T A 2: 76,711,969 K31812* probably null Het
Ube4b G A 4: 149,425,996 probably benign Het
Zbtb49 G A 5: 38,203,087 probably null Het
Zswim8 T A 14: 20,718,526 S1035T probably damaging Het
Other mutations in Vmn2r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Vmn2r91 APN 17 18105558 missense probably benign 0.00
IGL01121:Vmn2r91 APN 17 18136504 missense possibly damaging 0.94
IGL01464:Vmn2r91 APN 17 18107602 missense probably null 0.00
IGL02003:Vmn2r91 APN 17 18107659 missense probably benign
IGL02709:Vmn2r91 APN 17 18105449 missense possibly damaging 0.74
IGL02795:Vmn2r91 APN 17 18085277 missense probably benign 0.01
IGL02813:Vmn2r91 APN 17 18136086 missense possibly damaging 0.91
IGL02830:Vmn2r91 APN 17 18136622 missense probably benign 0.01
IGL03130:Vmn2r91 APN 17 18110111 splice site probably benign
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0393:Vmn2r91 UTSW 17 18105450 missense probably damaging 1.00
R1142:Vmn2r91 UTSW 17 18136443 missense probably damaging 1.00
R1603:Vmn2r91 UTSW 17 18106143 missense probably benign 0.04
R1992:Vmn2r91 UTSW 17 18135880 missense probably damaging 1.00
R2182:Vmn2r91 UTSW 17 18105429 missense possibly damaging 0.94
R2424:Vmn2r91 UTSW 17 18136169 nonsense probably null
R2512:Vmn2r91 UTSW 17 18135786 missense probably benign
R2885:Vmn2r91 UTSW 17 18105366 missense probably benign 0.00
R2909:Vmn2r91 UTSW 17 18136399 missense probably damaging 1.00
R3009:Vmn2r91 UTSW 17 18105455 missense probably benign 0.11
R3079:Vmn2r91 UTSW 17 18135711 splice site probably null
R3080:Vmn2r91 UTSW 17 18135711 splice site probably null
R3434:Vmn2r91 UTSW 17 18110108 splice site probably benign
R3723:Vmn2r91 UTSW 17 18085278 critical splice donor site probably null
R3829:Vmn2r91 UTSW 17 18105497 missense probably damaging 1.00
R3845:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R3846:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R4118:Vmn2r91 UTSW 17 18110096 missense probably damaging 1.00
R4285:Vmn2r91 UTSW 17 18135768 missense probably benign 0.00
R4729:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
R4793:Vmn2r91 UTSW 17 18105396 missense probably damaging 1.00
R4932:Vmn2r91 UTSW 17 18136489 missense possibly damaging 0.84
R5016:Vmn2r91 UTSW 17 18110060 nonsense probably null
R5018:Vmn2r91 UTSW 17 18136438 missense probably damaging 1.00
R5605:Vmn2r91 UTSW 17 18136501 missense probably damaging 1.00
R5815:Vmn2r91 UTSW 17 18106202 missense probably benign 0.01
R6146:Vmn2r91 UTSW 17 18136256 missense probably benign 0.07
R6187:Vmn2r91 UTSW 17 18106626 missense probably benign 0.05
R6450:Vmn2r91 UTSW 17 18085265 missense probably damaging 0.98
R6767:Vmn2r91 UTSW 17 18107545 missense probably damaging 0.98
R6986:Vmn2r91 UTSW 17 18136009 missense probably benign 0.10
R7112:Vmn2r91 UTSW 17 18105618 missense possibly damaging 0.83
R7178:Vmn2r91 UTSW 17 18136162 missense probably damaging 1.00
R7330:Vmn2r91 UTSW 17 18106167 missense probably damaging 1.00
R7368:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7380:Vmn2r91 UTSW 17 18136576 nonsense probably null
R7397:Vmn2r91 UTSW 17 18135798 missense probably benign 0.02
R7625:Vmn2r91 UTSW 17 18105431 missense probably damaging 1.00
R7739:Vmn2r91 UTSW 17 18135818 missense probably benign 0.00
R7749:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7755:Vmn2r91 UTSW 17 18110049 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTACATATACTGGCTACACATTGG -3'
(R):5'- TCATAGGCCAGAAAGCTCACAG -3'

Sequencing Primer
(F):5'- CTGGCTACACATTGGATATTAACATG -3'
(R):5'- CAGCAGAAGTCCAGACTA -3'
Posted On2018-05-24