Incidental Mutation 'R6426:Adgre4'
ID518340
Institutional Source Beutler Lab
Gene Symbol Adgre4
Ensembl Gene ENSMUSG00000032915
Gene Nameadhesion G protein-coupled receptor E4
SynonymsGpr127, EGF-TM7, FIRE, Emr4, D17Ertd479e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6426 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location55749984-55853662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55802196 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 401 (N401S)
Ref Sequence ENSEMBL: ENSMUSP00000025004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025004]
Predicted Effect probably benign
Transcript: ENSMUST00000025004
AA Change: N401S

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025004
Gene: ENSMUSG00000032915
AA Change: N401S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:EGF_like 38 76 2e-10 BLAST
Pfam:EGF_CA 77 117 3.6e-9 PFAM
GPS 288 338 4.03e-12 SMART
Pfam:7tm_2 343 588 5.7e-57 PFAM
low complexity region 613 628 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Adcyap1r1 T G 6: 55,494,187 L365R probably damaging Het
Adgrl3 A T 5: 81,726,870 S1073C probably damaging Het
Bicral G A 17: 46,830,079 P26S probably benign Het
Cst3 G T 2: 148,871,997 T129K probably benign Het
Cyp26a1 T C 19: 37,699,305 M287T probably benign Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dmxl1 T C 18: 49,864,578 V611A probably damaging Het
Fam149a C A 8: 45,381,574 A63S probably benign Het
Fam160b1 T G 19: 57,383,178 L574R probably damaging Het
Foxred2 C G 15: 77,953,308 A243P probably damaging Het
Gm3604 A T 13: 62,369,622 D307E probably damaging Het
Lca5 G A 9: 83,395,654 Q546* probably null Het
Mfsd4b1 T C 10: 40,006,077 T71A possibly damaging Het
Olfr76 A G 19: 12,119,848 V288A probably benign Het
Onecut1 A G 9: 74,862,349 H18R probably damaging Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Pcsk5 G T 19: 17,617,729 Q414K probably damaging Het
Ppp4r2 T C 6: 100,852,597 Y77H probably damaging Het
Prr19 A G 7: 25,303,837 D292G probably damaging Het
Pum1 G A 4: 130,753,972 R464H probably damaging Het
Rhoq G T 17: 86,995,014 R126L probably damaging Het
Sdhb A G 4: 140,973,718 K162E probably benign Het
Sema3d G A 5: 12,563,264 G436E probably damaging Het
Sf3b1 A T 1: 54,999,655 M823K probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Syne2 G T 12: 75,923,083 E977D probably null Het
Tns2 A T 15: 102,107,037 M125L possibly damaging Het
Ttn T A 2: 76,711,969 K31812* probably null Het
Ube4b G A 4: 149,425,996 probably benign Het
Vmn2r91 G A 17: 18,135,603 probably null Het
Zbtb49 G A 5: 38,203,087 probably null Het
Zswim8 T A 14: 20,718,526 S1035T probably damaging Het
Other mutations in Adgre4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adgre4 APN 17 55791915 splice site probably benign
IGL00228:Adgre4 APN 17 55802135 missense probably damaging 1.00
IGL00572:Adgre4 APN 17 55820648 missense probably benign 0.00
IGL01404:Adgre4 APN 17 55797639 missense possibly damaging 0.63
IGL01420:Adgre4 APN 17 55799785 splice site probably benign
IGL01501:Adgre4 APN 17 55802002 splice site probably benign
IGL01510:Adgre4 APN 17 55818760 critical splice donor site probably null
IGL01554:Adgre4 APN 17 55817090 missense probably damaging 1.00
IGL01607:Adgre4 APN 17 55794748 splice site probably benign
IGL01767:Adgre4 APN 17 55797740 missense probably benign 0.19
IGL02253:Adgre4 APN 17 55760573 missense probably benign 0.01
IGL02358:Adgre4 APN 17 55843209 missense probably benign 0.15
IGL02466:Adgre4 APN 17 55814188 missense probably benign 0.42
IGL03057:Adgre4 APN 17 55799602 splice site probably benign
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0111:Adgre4 UTSW 17 55817073 missense possibly damaging 0.92
R0311:Adgre4 UTSW 17 55802010 missense probably benign 0.36
R0366:Adgre4 UTSW 17 55792001 nonsense probably null
R0415:Adgre4 UTSW 17 55852288 missense probably benign 0.03
R0465:Adgre4 UTSW 17 55785137 splice site probably benign
R0619:Adgre4 UTSW 17 55820679 missense possibly damaging 0.52
R0685:Adgre4 UTSW 17 55792035 missense probably benign 0.05
R0724:Adgre4 UTSW 17 55852281 missense probably benign 0.00
R0835:Adgre4 UTSW 17 55799637 missense probably damaging 1.00
R1330:Adgre4 UTSW 17 55778814 missense probably benign 0.36
R1452:Adgre4 UTSW 17 55784996 missense probably benign 0.35
R1960:Adgre4 UTSW 17 55791497 missense probably benign
R1961:Adgre4 UTSW 17 55791497 missense probably benign
R2046:Adgre4 UTSW 17 55778847 missense possibly damaging 0.82
R2421:Adgre4 UTSW 17 55778872 missense probably benign 0.10
R2570:Adgre4 UTSW 17 55778878 missense possibly damaging 0.54
R3162:Adgre4 UTSW 17 55802218 splice site probably benign
R4222:Adgre4 UTSW 17 55785121 missense probably damaging 1.00
R4526:Adgre4 UTSW 17 55785016 nonsense probably null
R4631:Adgre4 UTSW 17 55814305 missense probably null 1.00
R4689:Adgre4 UTSW 17 55802096 missense probably damaging 1.00
R4701:Adgre4 UTSW 17 55784971 missense probably damaging 1.00
R4792:Adgre4 UTSW 17 55791491 missense probably benign 0.00
R5205:Adgre4 UTSW 17 55794727 nonsense probably null
R5210:Adgre4 UTSW 17 55785029 missense probably damaging 0.97
R5358:Adgre4 UTSW 17 55818758 missense probably benign 0.00
R5873:Adgre4 UTSW 17 55852282 missense probably benign 0.13
R6025:Adgre4 UTSW 17 55792013 missense probably benign 0.00
R6257:Adgre4 UTSW 17 55802133 missense possibly damaging 0.87
R6440:Adgre4 UTSW 17 55794744 critical splice donor site probably null
R6484:Adgre4 UTSW 17 55802036 missense possibly damaging 0.52
R6680:Adgre4 UTSW 17 55791959 missense probably benign 0.09
R7086:Adgre4 UTSW 17 55820649 missense probably benign 0.00
R7442:Adgre4 UTSW 17 55852340 missense probably benign 0.04
R7467:Adgre4 UTSW 17 55791952 missense probably benign 0.00
R7875:Adgre4 UTSW 17 55792016 missense probably benign 0.00
R7958:Adgre4 UTSW 17 55792016 missense probably benign 0.00
R8007:Adgre4 UTSW 17 55814233 missense probably damaging 0.99
S24628:Adgre4 UTSW 17 55852288 missense probably benign 0.03
X0010:Adgre4 UTSW 17 55814308 missense probably damaging 1.00
Z1177:Adgre4 UTSW 17 55814152 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCCTTTCTGGTCTGTAGGAG -3'
(R):5'- ACTGTAGAGTGACATTACTGCTAG -3'

Sequencing Primer
(F):5'- CCTTTCTGGTCTGTAGGAGGATGG -3'
(R):5'- TACTCCTAATTCCAAAATGACCAAC -3'
Posted On2018-05-24