Mutagenetix > Incidental Mutation

Incidental Mutation 'R6427:Stxbp5'

518365

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

LGL3, tomosyn 1, 0710001E20Rik, 4930565N16Rik

MMRRC Submission

044566-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6427 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9631291-9776823 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9774998 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 52 (T52A)

Ref Sequence

ENSEMBL: ENSMUSP00000121507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]

AlphaFold

Q8K400

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038213
AA Change: T52A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: T52A

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000125200
AA Change: T52A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: T52A

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141722
AA Change: T52A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: T52A

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218800

Meta Mutation Damage Score

0.3967

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

93% (39/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	C	T	16: 8,420,300 (GRCm39)		probably benign	Het
Ankmy2	A	G	12: 36,237,710 (GRCm39)	S270G	possibly damaging	Het
Anxa2	T	A	9: 69,383,431 (GRCm39)		probably null	Het
Arid1a	G	T	4: 133,408,835 (GRCm39)	P1891T	unknown	Het
Atn1	G	T	6: 124,723,139 (GRCm39)		probably benign	Het
Atp8b3	A	T	10: 80,356,157 (GRCm39)		probably null	Het
Cab39l	A	C	14: 59,743,719 (GRCm39)	K94N	possibly damaging	Het
Cacna2d2	G	T	9: 107,392,641 (GRCm39)	M528I	possibly damaging	Het
Ccnc	T	A	4: 21,747,578 (GRCm39)		probably null	Het
Cfap251	T	C	5: 123,464,596 (GRCm39)	L1268P	probably damaging	Het
Clasp2	C	T	9: 113,721,512 (GRCm39)	T774I	probably damaging	Het
Cngb1	C	T	8: 96,024,387 (GRCm39)		probably benign	Het
Cpt1a	T	A	19: 3,412,156 (GRCm39)	F209L	probably damaging	Het
Cyp2j7	C	A	4: 96,115,904 (GRCm39)	D181Y	probably damaging	Het
Daam2	C	T	17: 49,776,404 (GRCm39)	E828K	probably damaging	Het
Ddr1	C	A	17: 35,998,114 (GRCm39)	R477L	probably benign	Het
Ech1	A	G	7: 28,525,310 (GRCm39)	T22A	probably benign	Het
Fbln5	T	C	12: 101,728,081 (GRCm39)	D294G	possibly damaging	Het
Fkbp15	T	C	4: 62,241,439 (GRCm39)	I569V	probably benign	Het
Hmcn1	G	T	1: 150,573,227 (GRCm39)	R2141S	possibly damaging	Het
Kat6b	T	C	14: 21,567,480 (GRCm39)	S180P	probably benign	Het
Lepr	G	A	4: 101,631,454 (GRCm39)	E655K	possibly damaging	Het
Mro	T	A	18: 74,005,104 (GRCm39)	L69Q	probably damaging	Het
Nipbl	A	T	15: 8,381,049 (GRCm39)	L581H	probably benign	Het
Nkiras2	C	T	11: 100,515,861 (GRCm39)	R63W	probably damaging	Het
Nlrp4e	T	A	7: 23,020,058 (GRCm39)	S182T	possibly damaging	Het
Obi1	T	C	14: 104,717,662 (GRCm39)	K237R	possibly damaging	Het
Or52b4i	A	T	7: 102,191,895 (GRCm39)	I251F	probably benign	Het
Otud4	T	C	8: 80,395,126 (GRCm39)	S553P	probably benign	Het
Pcdha4	T	C	18: 37,086,786 (GRCm39)	I323T	probably benign	Het
Polr1b	G	T	2: 128,965,181 (GRCm39)	A756S	probably damaging	Het
Prex2	A	T	1: 11,252,255 (GRCm39)	Y1100F	probably damaging	Het
Serpinb6a	A	T	13: 34,102,242 (GRCm39)	S328T	probably damaging	Het
Srsf11	C	T	3: 157,728,981 (GRCm39)		probably benign	Het
Taf3	A	T	2: 9,956,164 (GRCm39)	F515I	probably damaging	Het
Unc13b	A	G	4: 43,176,966 (GRCm39)		probably benign	Het
Vmn2r106	C	T	17: 20,488,725 (GRCm39)	C558Y	probably damaging	Het
Vps51	T	C	19: 6,120,947 (GRCm39)	Y322C	possibly damaging	Het
Zfp735	G	A	11: 73,581,140 (GRCm39)	C59Y	possibly damaging	Het
Zfp759	A	G	13: 67,287,162 (GRCm39)		probably null	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9,675,694 (GRCm39)	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9,684,346 (GRCm39)	splice site	probably benign
IGL01725:Stxbp5	APN	10	9,693,155 (GRCm39)	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9,638,565 (GRCm39)	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9,692,041 (GRCm39)	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9,638,700 (GRCm39)	nonsense	probably null
IGL02720:Stxbp5	APN	10	9,665,105 (GRCm39)	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9,692,034 (GRCm39)	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9,742,447 (GRCm39)	splice site	probably null
Fatty_fish	UTSW	10	9,646,295 (GRCm39)	missense	probably damaging	1.00
reindeer	UTSW	10	9,713,836 (GRCm39)	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9,645,187 (GRCm39)	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9,693,048 (GRCm39)	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9,638,492 (GRCm39)	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9,638,492 (GRCm39)	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9,646,272 (GRCm39)	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9,742,442 (GRCm39)	splice site	probably benign
R0631:Stxbp5	UTSW	10	9,660,102 (GRCm39)	missense	probably benign
R0723:Stxbp5	UTSW	10	9,644,617 (GRCm39)	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9,740,843 (GRCm39)	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9,740,843 (GRCm39)	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9,684,784 (GRCm39)	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9,688,135 (GRCm39)	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9,692,013 (GRCm39)	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9,713,836 (GRCm39)	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9,688,042 (GRCm39)	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9,688,042 (GRCm39)	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9,688,042 (GRCm39)	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9,688,042 (GRCm39)	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9,688,042 (GRCm39)	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9,711,590 (GRCm39)	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9,644,671 (GRCm39)	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9,645,163 (GRCm39)	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9,665,060 (GRCm39)	intron	probably benign
R4572:Stxbp5	UTSW	10	9,713,888 (GRCm39)	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9,646,367 (GRCm39)	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9,638,635 (GRCm39)	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9,638,635 (GRCm39)	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9,688,085 (GRCm39)	nonsense	probably null
R4887:Stxbp5	UTSW	10	9,684,844 (GRCm39)	missense	probably benign
R4930:Stxbp5	UTSW	10	9,636,610 (GRCm39)	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9,646,295 (GRCm39)	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9,674,019 (GRCm39)	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9,675,735 (GRCm39)	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9,684,252 (GRCm39)	missense	probably benign
R5531:Stxbp5	UTSW	10	9,638,668 (GRCm39)	nonsense	probably null
R5605:Stxbp5	UTSW	10	9,645,490 (GRCm39)	intron	probably benign
R5614:Stxbp5	UTSW	10	9,636,638 (GRCm39)	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9,776,330 (GRCm39)	missense	probably benign
R5990:Stxbp5	UTSW	10	9,711,677 (GRCm39)	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9,675,772 (GRCm39)	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9,646,430 (GRCm39)	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9,684,216 (GRCm39)	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9,693,083 (GRCm39)	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9,642,931 (GRCm39)	missense	probably damaging	1.00
R6284:Stxbp5	UTSW	10	9,642,923 (GRCm39)	missense	probably benign	0.32
R6394:Stxbp5	UTSW	10	9,774,975 (GRCm39)	nonsense	probably null
R6894:Stxbp5	UTSW	10	9,660,105 (GRCm39)	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9,673,931 (GRCm39)	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9,684,874 (GRCm39)	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9,645,154 (GRCm39)	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9,684,248 (GRCm39)	missense	probably benign
R7974:Stxbp5	UTSW	10	9,646,439 (GRCm39)	splice site	probably null
R8009:Stxbp5	UTSW	10	9,692,046 (GRCm39)	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9,660,129 (GRCm39)	missense	probably benign
R8353:Stxbp5	UTSW	10	9,684,792 (GRCm39)	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9,688,003 (GRCm39)	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9,684,792 (GRCm39)	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9,688,033 (GRCm39)	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9,693,050 (GRCm39)	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9,713,859 (GRCm39)	nonsense	probably null
R9172:Stxbp5	UTSW	10	9,645,152 (GRCm39)	missense	possibly damaging	0.94
R9472:Stxbp5	UTSW	10	9,719,101 (GRCm39)	missense	probably damaging	1.00
R9513:Stxbp5	UTSW	10	9,687,754 (GRCm39)	missense	probably benign	0.17
R9649:Stxbp5	UTSW	10	9,774,938 (GRCm39)	missense	probably damaging	0.96
X0020:Stxbp5	UTSW	10	9,638,634 (GRCm39)	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9,776,289 (GRCm39)	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGTAGGAACGACTGAGAGCC -3'
(R):5'- TGCCCTCTGTGAAGTTACTAGC -3'

Sequencing Primer
(F):5'- GCCTGCACCACATAATTTCTTATAG -3'
(R):5'- GCTTGTTCCTTAAGATAGAGTCCAC -3'

Posted On

2018-05-24